Multi-domain conformational selection underlies pre-mRNA splicing regulation by U2AF

Abstract

Many cellular functions involve multi-domain proteins, which are composed of structurally independent modules connected by flexible linkers. Although it is often well understood how a given domain recognizes a cognate oligonucleotide or peptide motif, the dynamic interaction of multiple domains in the recognition of these ligands remains to be characterized. Here we have studied the molecular mechanisms of the recognition of the 3'-splice-site-associated polypyrimidine tract RNA by the large subunit of the human U2 snRNP auxiliary factor (U2AF65) as a key early step in pre-mRNA splicing. We show that the tandem RNA recognition motif domains of U2AF65 adopt two remarkably distinct domain arrangements in the absence or presence of a strong (that is, high affinity) polypyrimidine tract. Recognition of sequence variations in the polypyrimidine tract RNA involves a population shift between these closed and open conformations. The equilibrium between the two conformations functions as a molecular rheostat that quantitatively correlates the natural variations in polypyrimidine tract nucleotide composition, length and functional strength to the efficiency to recruit U2 snRNP to the intron during spliceosome assembly. Mutations that shift the conformational equilibrium without directly affecting RNA binding modulate splicing activity accordingly. Similar mechanisms of cooperative multi-domain conformational selection may operate more generally in the recognition of degenerate nucleotide or amino acid motifs by multi-domain proteins.

Encoded loop-lanthanide-binding tags for long-range distance measurements in proteins by NMR and EPR spectroscopy

“…A survey of the Protein Data Bank (PDB) (Bernstein et al 1977) reveals that structures of multi-domain proteins and protein-protein complexes solved by NMR spectroscopy are highly underrepresented compared to monomeric proteins. Recent studies (Mackereth et al 2011;Lapinaite et al 2013;Duss et al 2014;Alonso-García et al 2015) on biomacromolecules and their D. Barthelmes, M. Gränz and K. Barthelmes have contributed equally.…”

NMR Spectroscopy as a Tool to Provide Mechanistic Clues About Protein Function and Disease Pathogenesis

“…It is now possible to describe not only the structural consequences of disease-linked mutations located in well-folded domains but also their impact on the structural organisation of modular proteins (Mackereth et al, 2011). Such results provide mechanistic clues about how partially folded proteins use conformational switches in order to regulate their functions and highlight the connection between conformational variability, interaction and disease pathogenesis.…”

The thermodynamic patterns of eukaryotic genes suggest a mechanism for intron–exon recognition

“…However, the region of most pronounced DNA/DNA bias coincides with the PPT, which is known to be required for proper splicing 2,6,54,55 . This raises the question whether the PPT is required to ensure the DNA/DNA bias necessary to prevent the re-annealing of mRNA to DNA only or its degenerative nucleotide composition is sufficient to guarantee specific U2AF binding and spliceosome recruitment.…”

“…Pre-spliceosome A complex assembly was carried out as described previously 55,60 . The 32P-UTP-radiolabelled RNA substrate (5 0 -gggaagcuugcugcacgucuagggcgcaguaguccaggguuuccuugaugauguc auacuuauccugucccuuuuuuuuccacagCUCGCGGUUGAGGACAAACUCUUCGC GGUCUUUCCAGUGGGGAUCC-3 0 ), which includes 85 bp from the 3 0 -half of intron 1 and 46 bp of exon 2 of AdML transcript, was transcribed in vitro by T7 polymerase.…”