Multidrug resistance gene expression during the murine ontogeny

Schiengold, Marion; Schwantes, Lavı́nia; Schwartsmann, Gilberto; Nardi, Nance Beyer

doi:10.1016/s0047-6374(00)00223-2

Cited by 20 publications

(17 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In the proestrus ovaries, it was also possible to observe the expression of mdr1 in the absence of mdr3 expression. Although this data concerns only one animal, this was never observed in ovaries before, as discussed in our previous study, where we stated that mdr1 and mdr3 expression were always concomitant (Schiengold et al, 2001). Noteworthy, considering the homologous genes to mouse mdr1 and mdr3 in humans, is that the activation of the MDR3 gene seems to be independent of the activation of the closely linked MDR1 gene (van der Bliek et al, 1988;Raymond et al, 1990;Chin et al, 1992).…”

Section: Discussionmentioning

confidence: 54%

“…In the other organs, the patterns of expression were uniform throughout all phases (not shown). As detailed elsewhere (Schiengold et al, 2001), all isoforms are seen in all organs, with considerable individual variation. Table 1 shows the results obtained for the presence or absence of mdr isoforms in the adrenal gland and ovary, for each estrous phase analyzed.…”

Section: Expression Of Mdr Isoforms During the Estrous Cyclementioning

confidence: 66%

“…The primer sequences were 5'TGCTTATGGATCC CAGAGTGAC3' and 5'TTGGTGAGGATCTCTCCGG CT3' for mdr1; 5'CTCGTTAACATGCAGACAGCAG3' and 5'GACCAGGGAGAACATGTTACAC3' for mdr2; 5'AGCTATCACGGACAACATCTCC3' and 5'TGTCC GCTCTTCACCTTCAGAT3' for mdr3; and 5'GAAAGA TGGTGAACTATGCC3' and 5'TTACCAAAAGTGGCC CACTA3' for rRNA, as previously described by us in Schiengold et al (2001).…”

Section: Pcrmentioning

confidence: 99%

“…In a previous work (Schiengold et al, 2001), we investigated the expression of the mdr isoforms during murine ontogeny. The three isoforms were observed in all eight organs analyzed (spleen, brain, liver, adrenal gland, intestine, kidney, testes and ovaries), although with different frequencies.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Expression of mdr isoforms in mice during estrous cycle and under hormone stimulation

et al. 2006

Self Cite

View full text Add to dashboard Cite

The multidrug resistance (MDR) phenotype is associated with the expression of P-glycoprotein (Pgp), coded by the multigenic mdr family. Mice present the isoforms mdr1 and mdr3, which are responsible for multidrug resistance, and mdr2, that is involved in the transport of phospholipids. mdr1 expression has more recently been associated also with the secretion of steroid hormones. This work presents an RT-PCR analysis of the expression of mdr isoforms, in several organs of mice during different phases of the estrous cycle. Additionally, females were ovariectomized, submitted to different hormone treatments, and their uterus was analyzed for the expression of mdr isoforms. The results show that in the adrenal gland and ovaries mdr1 is the main isoform during proestrus, and that progesterone or a combination of progesterone and estrogen induce the expression of all mdr isoforms in the uterus of ovariectomized females. We suggest that the functions of mdr1 and mdr3 are overlapping, that mdr3 may be the more efficient isoform in the detoxification function, and that mdr1 may be more closely related to the secretion of steroid hormones.

show abstract

Section: Discussionmentioning

confidence: 54%

Section: Expression Of Mdr Isoforms During the Estrous Cyclementioning

confidence: 66%

Section: Pcrmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Expression of mdr isoforms in mice during estrous cycle and under hormone stimulation

et al. 2006

Self Cite

View full text Add to dashboard Cite

show abstract

“…Schiengold et al studied the development of mdr1, mdr2 and mdr3 in both BALB/c and C57BL/6 mice using RT-PCR (alternative nomenclature uses mdr1 for mdr1b and mdr3 for mdr1a) (10). The kidney as an organ was characterized by the overall homology with mdrlb, (6) BLAST 2 sequence was used to align the two sequences to find the areas that had the least homology.…”

mentioning

confidence: 99%

Ontogeny of Renal P-glycoprotein Expression in Mice: Correlation with Digoxin Renal Clearance

et al. 2005

View full text Add to dashboard Cite

Digoxin is eliminated mainly by the kidney through glomerular filtration and P-glycoprotein (P-gp) mediated tubular secretion. Toddlers and young children require higher doses of digoxin per kilogram of bodyweight than adults, although the reasons for this have not been elucidated. We hypothesized there is an age-dependant increase in P-gp expression in young children. The objectives of this study were to elucidate agedependant expression of renal P-gp and its correlation with changes in the clearance rate of digoxin. FVB mice were killed at different ages to prepare total RNA for P-gp expression studies. Semi-quantitative RT-PCR was conducted to analyze mdr1a and mdr1b ontogeny in the kidney at: birth, 7, 14, 21, 28 and 45-d old adults. The pharmacokinetics of digoxin (7 g/kg)was studied in mice of the same age groups. Newborn and Day 7 levels of both mdr1a and mdr1b were marginal. Day 21 mdr1b levels were significantly higher than both Day 14 and Day 28 levels. Digoxin clearance rates were the highest at Day 21, with significant correlation between P-gp expression and clearance values. Increases in digoxin clearance rates after weaning may be attributed, at least in part, to similar increases in P-gp expression. The kidney is a major port of exit from the body for numerous drugs and/or their metabolites. The ontogeny of renal handling of drugs has been considered in depth only in the context of low clearance rates in newborn infants in both clinical and experimental studies. Yet, there is evidence that in the post neonatal period, the young child needs much larger doses of renally excreted drugs compared with older children and adults. In the case of digoxin, which is frequently used in pediatrics and excreted mostly by the kidney, a neonate typically requires a daily dose of 5 g/kg, the toddler and young child need 10 -12 g/kg per day, whereas older children and adults need 8 -10 g/kg and 3-5 g/kg respectively (1).The mechanisms underlying these developmental changes have not been elucidated. The kidney clears most of the body load of digoxin by both glomerular filtration and tubular secretion, with digoxin half-lives in children varying consistently with renal clearance (2,3). Tubular secretion of digoxin is mediated by the P-glycoprotein (P-gp) transporter, encoded by the mdr1 gene (4). Presently, the ontogeny of renal P-gp has been sparsely studied and never linked directly to the elimination characteristics of digoxin, or other P-gp substrates. Whereas P-gp in humans is encoded by the one gene, MDR1, there are two genes responsible for encoding this drug transporter in murine kidney: mdr1a and mdr1b (5,6). The two genes are believed to have risen through gene duplication from a common precursor (7). Mdr1b was shown to be expressed at high levels in the pregnant uterus and the adrenal gland and expressed at intermediate levels in kidney and heart tissue (5). Longer exposures also revealed limited expression in muscle, brain, liver, spleen, and lungs. On the other hand, mdr1a is expressed at high levels in ...

show abstract

St John's wort modulation and developmental expression of multidrug transporters in the rat

Garrovo

Rosati

Bartoli

et al. 2006

Phytotherapy Research

View full text Add to dashboard Cite

Extracts of St John's wort (SJW) (Hypericum perforatum) are a potent inducer of enzymes of the cytochrome P450 system and of the transport protein P-glycoprotein, and interactions with a range of commonly prescribed medications have been described. In addition, recent experimental data suggest that, this otherwise safe treatment, could have some side effects when consumed during pregnancy and lactation. The aim of this study was to investigate, in Wistar rats, the effect of a treatment with high doses of SJW extract (100 and 1000 mg/kg/day) administered prenatally and during breastfeeding, on the level of transcripts of mdr1a, mdr1b, mrp1, mrp2 and cyp3A2 genes. All transcripts were detected in the liver, and their level of expression increased from fetuses to adults. SJW administration, at both dosages, caused a significant decrease of the levels of mdr1a, mdr1b, mrp1 and mrp2 in the livers of fetuses, and an increase in the levels of mdr1a, mdr1b, mrp2 and cyp3A2 in the mothers. In the other organs examined, a physiological regulation during ontogenesis was also evident, but SJW administration did not modify the expression level of the considered transcripts. These data suggest that the administration of the extract together with drugs that are substrates of transport proteins could be particularly hazardous during pregnancy.

show abstract

Multidrug resistance gene expression during the murine ontogeny

Cited by 20 publications

References 37 publications

Expression of mdr isoforms in mice during estrous cycle and under hormone stimulation

Expression of mdr isoforms in mice during estrous cycle and under hormone stimulation

Ontogeny of Renal P-glycoprotein Expression in Mice: Correlation with Digoxin Renal Clearance

St John's wort modulation and developmental expression of multidrug transporters in the rat

Contact Info

Product

Resources

About