Multiplex real‐time PCR assay for the detection of three invasive leafminer species: <i>Liriomyza huidobrensis, L. sativae</i> and <i>L. trifolii</i> (Diptera: Agromyzidae)

Sooda, Anuradha; Gunawardana, Disna N.; Li, Dongmei; Kumarasinghe, Lalith

doi:10.1111/aen.12237

Cited by 8 publications

(9 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

Section: Discussionmentioning

confidence: 99%

“…Multiplex PCR assays were recently developed for identification of Liriomyza species ( Miura et al, 2004 ; Guan et al, 2006 ; Nakamura et al, 2013 ) and are based on amplification of a target gene region using species-specific primer combinations. Multiplex PCR assays are easier and faster than other molecular methods, such as RAPD-PCR, PCR-RFLP, DNA barcoding and real-time PCR ( Chiu et al, 2000 ; Morgan et al, 2000 ; Scheffer et al, 2001 ; Kox et al, 2005 ; Scheffer, Lewis & Ravindra, 2006 ; Blacket et al, 2015 ; Sooda et al, 2017 ); furthermore, multiplex PCR assays are more sensitive than enzyme electrophoresis methods ( Zehnder, Trumble & White, 1983 ; Menken & Ulenberg, 1983 ; Minkenberg & Van Lenteren, 1986 ; Oudman et al, 1995 ). In general, the reliability and sensitivity of multiplex PCR represents a great improvement in molecular identification protocols and will enable us to manage invasive pests more effectively.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Revalidation of morphological characteristics and multiplex PCR for the identification of three congener invasive Liriomyza species (Diptera: Agromyzidae) in China

Chang

Chen

Zheng³

et al. 2020

PeerJ

View full text Add to dashboard Cite

Due to varietal differences, diminutive size, and similar morphological characters, it is difficult to classify and identify Liriomyza spp., a genus comprised of economically-important, highly-polyphagous insect pests. In this study, we reconfirmed the morphological characteristics of three closely-related invasive leafminers, L. trifolii, L. sativae, and L. huidobrensis. Morphological results showed that characteristics imparted by the male genitalia were the most reliable morphological features for identification. The colors exhibited by vertical setae were variable among species, and the ratio of the length of the ultimate section of vein CuA1 divided by penultimate section also varied within species. Although the patterns of abdominal tergites were diverse among Liriomyza spp., L. trifolii exhibited a unique pattern with a yellow patch at the 5th black visible tergite; this pattern can be profiled as a prominent characteristic for morphological identification. In order to identify the three Liriomyza spp. quickly and accurately, we developed an improved molecular identification method using multiplex PCR based on the gene encoding mitochondrial cytochrome oxidase I (COI); this method enabled direct identification based on the size of amplified products. The results of this study provide a valuable reference for the identification of Liriomyza spp., which will ultimately improve our ability to control individual species.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Revalidation of morphological characteristics and multiplex PCR for the identification of three congener invasive Liriomyza species (Diptera: Agromyzidae) in China

Chang

Chen

Zheng³

et al. 2020

PeerJ

View full text Add to dashboard Cite

show abstract

“…The amplicons were electrophoresed on 1.2% agarose (in 1× TAE buffer) gel stained with SYBR ® safe (Life Technologies™), and visualized using a Gel Doc Software system (Bio‐Rad, Hercules, CA, USA). Amplified products were sequenced bidirectionally using the amplification primers, and DNA sequences were analysed as previously described (Li et al, ; Li, Waite, Fan, et al, ; Li, Waite, Gunawardana, et al, ; Sooda, Gunawardana, Li, & Kumarasinghe, ). The DNA sequences were submitted to BOLD database under the project of “Barcode of Bactrocera Specimens” (BBS): BBS050‐18 to BBS055‐18 for Z. cucumis and BBS056‐18 to BBS060‐18 for B. jarvisi .…”

Section: Methodsmentioning

confidence: 99%

Real‐time PCR assays for rapid detection of Zeugodacus cucumis and Bactrocera jarvisi (Diptera: Tephritidae) for quarantine application

Nair

Anderson

et al. 2018

J Applied Entomology

Self Cite

View full text Add to dashboard Cite

Zeugodacus cucumis and Bactrocera jarvisi are pests of fruit and vegetable crops and cause damage to horticulture industries. Immature stages of these two fruit fly species have been intercepted in New Zealand a number of times. Identification to species was not possible using morphological characters; thus, it is important to develop an assay for their species‐level identification. Here, the real‐time PCR assays for rapid identification of Z. cucumis and B. jarvisi were developed and validated. The PCR protocols demonstrated their specificity by amplifying the two target species successfully, with no cross‐reactions observed in the tested tephritid species. The in silico test of the primer and probe binding sites of the two assays also demonstrated the assays’ specificity by no mismatches present in the binding regions of the target species, but 1–4 mismatches in the binding regions of the non‐target fruit fly species. The thresholds of detection for the two assays are as low as 10 copies/µl of the target DNA, indicating that the assays have a very high sensitivity. The application of the real‐time PCR assays has greatly assisted in routine pest identifications at the New Zealand border and surveillance programme. Therefore, the assays have the potential to be used by diagnostic agencies and research organizations worldwide.

show abstract

“…Species-specific PrimeTime qPCR assays (Integrated DNA Technologies) were used to target a 109 base pair (bp) fragment of the mitochondrial CO1 gene of L. sativae with sequences as described in Sooda et al (2017) with the addition of two degenerate bases in the probe to accommodate sequence variants found within the Torres Strait Islands: NCBI accession KR476580 Haplotype S.28 (Blacket et al 2015) and KR476573 Haplotype S.7 (Blacket et al 2015). Forward primer SAT-F ACCCCCTGCTTTAACTCTTTT, reverse primer SAT-R AGCACCACCATGTGCAATAA and reporter probe SAT-P CAGTATAGTAGAAAATGGRGCTGGRA with a 6-FAM/ZEN/IBFQ modification.…”

Section: Molecular Assaysmentioning

confidence: 99%

A molecular method for biomonitoring of an exotic plant-pest: Leafmining for environmental DNA

Pirtle¹,

Rooyen

Maino³

et al. 2020

Preprint

View full text Add to dashboard Cite

1. Understanding how invasive species respond to novel environments is limited by a lack of sensitivity and throughput in conventional biomonitoring methods. Arthropods in particular are often difficult to monitor due to small size, rapid lifecycles, and/or visual similarities with co-occurring species. This is true for the agromyzid leafminer, Liriomyza sativae, a global pest of vegetable and nursery industries that has recently established in Australia. 2. A highly robust method based on environmental DNA (eDNA) was developed exploiting traces of DNA left inside 'empty' leaf mines, which are easier to collect and persist longer in the environment than the insect. This extended the window of possible diagnosis to at least 28 days since a leaf mine became empty. The test allowed for visually indistinguishable leafmining damage caused by L. sativae to be genetically differentiated from that of other flies. 3. Field application resulted in the identification of new local plant hosts for L. sativae, including widely distributed weeds and common garden crops, with important implications for the pest's ability to spread. Moreover, the test allowed for the confirmation of L. sativae on an island with a previously unconfirmed population. 4. The developed eDNA method is likely to become an important tool for L. sativae and other leafmining species of biosecurity significance, which, historically, have been difficult to detect, diagnose and monitor. More generally, eDNA is emerging as a highly sensitive and labour-efficient surveillance tool for difficult to survey species to improve outcomes for agricultural industries, global health, and the environment.

show abstract

Multiplex real‐time PCR assay for the detection of three invasive leafminer species: Liriomyza huidobrensis, L. sativae and L. trifolii (Diptera: Agromyzidae)

Cited by 8 publications

References 29 publications

Revalidation of morphological characteristics and multiplex PCR for the identification of three congener invasive Liriomyza species (Diptera: Agromyzidae) in China

Revalidation of morphological characteristics and multiplex PCR for the identification of three congener invasive Liriomyza species (Diptera: Agromyzidae) in China

Real‐time PCR assays for rapid detection of Zeugodacus cucumis and Bactrocera jarvisi (Diptera: Tephritidae) for quarantine application

A molecular method for biomonitoring of an exotic plant-pest: Leafmining for environmental DNA

Contact Info

Product

Resources

About