Mutations in EMP2 Cause Childhood-Onset Nephrotic Syndrome

Abstract

Nephrotic syndrome (NS) is a genetically heterogeneous group of diseases that are divided into steroid-sensitive NS (SSNS) and steroid-resistant NS (SRNS). SRNS inevitably leads to end-stage kidney disease, and no curative treatment is available. To date, mutations in more than 24 genes have been described in Mendelian forms of SRNS; however, no Mendelian form of SSNS has been described. To identify a genetic form of SSNS, we performed homozygosity mapping, whole-exome sequencing, and multiplex PCR followed by next-generation sequencing. We thereby detected biallelic mutations in EMP2 (epithelial membrane protein 2) in four individuals from three unrelated families affected by SRNS or SSNS. We showed that EMP2 exclusively localized to glomeruli in the kidney. Knockdown of emp2 in zebrafish resulted in pericardial effusion, supporting the pathogenic role of mutated EMP2 in human NS. At the cellular level, we showed that knockdown of EMP2 in podocytes and endothelial cells resulted in an increased amount of CAVEOLIN-1 and decreased cell proliferation. Our data therefore identify EMP2 mutations as causing a recessive Mendelian form of SSNS.

Genomic and clinical profiling of a national nephrotic syndrome cohort advocates a precision medicine approach to disease management

“…This needs further information from extended cohorts, as there are case reports of patients with a genetic mutation who have responded to steroids, at least partially (e.g. PLCe1, EMP2, TRPC6) 19,20 . Since some genetic SRNS may respond, the question of whether response to secondary immunosuppression such as calcineurin inhibitors indicates a non-genetic disease remains open, and is a longer term aim of this cohort to address.…”

Loss of Epithelial Membrane Protein 2 Aggravates Podocyte Injury via Upregulation of Caveolin-1

“…The sequence of shRNA#1 was previously reported. 3 Arrowhead indicates the cleaved CASPASE-3. (B) Quantitation of CASPASE-3 activity in cultured human podocytes.…”

“…Podocytes stably transfected with scrambled or EMP2 shRNAs, and myc-tagged EMP2 expression constructs (myc-EMP2,myc-EMP2 Q62* , myc-emp2(zebrafish), mycemp2 MT (zebrafish emp2 mutant)) were previously described. 3 The target sequence of shRNAs is GCGTGAAGACATTCACGACAA (shRNA #1). The shRNA-stable podocytes were selected and maintained with 8 mg/ml puromycin.…”

“…2 Using the combined approach of homozygosity mapping and whole-exome sequencing, we have previously identified mutations in epithelial membrane protein 2 (EMP2) as a novel monogenic cause for NS. 3 EMP2 was initially identified by its homology with the growth-arrest-specific 3/peripheral myelin protein 22 family 4 and negatively regulates the mRNA and protein levels of CAV1, a major protein component of plasma membrane microdomain caveolae. 5,6 To explore the pathogenic mechanism underlying EMP2 mutations, we have now generated emp2 deletion mutant zebrafish and caveolin 1 (cav1)-overexpressing transgenic zebrafish.…”

Reporting genomic secondary findings: ACMG members weigh in

“…It can also characterize new diseases or genetic syndromes by identifying pathogenic variants in novel or candidate genes and further define phenotypic aspects of genetic disorders. [4][5][6] However, as is true with Sanger (or single-gene) sequencing, massively parallel sequencing has limitations; certain pathogenic variants are missed and variants of uncertain significance often are detected. 7 As with other broad genetic tests, when sequencing the exome or genome, findings unrelated to the original indication for testing are identified.…”