n-3 PUFA reduction caused by fabp2 deletion interferes with triacylglycerol metabolism and cholesterolhomeostasis in fish

Zhao, Yan; Cao, Xiaojuan; Fu, Lele; Gao, Jian

doi:10.1007/s00253-020-10366-9

Cited by 18 publications

(12 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In vitro transcription of Cas9 RNA and gRNA were based on the standards of the relevant research ( Moreno-Mateos et al., 2015 ). Detailed construction methods were performed as previously described ( Zhao et al., 2020 ). The genomic DNA was isolated from 6 randomly selected fertilized embryos.…”

Section: Methodsmentioning

confidence: 99%

“…Total RNA was extracted by using RNA isoPius following the manufacturer’s instructions (TaKaRa, Japan). Detailed methods were performed as previously described ( Zhao et al., 2020 ). The 2 –ΔΔCT method was used to analyze the expression levels of the target genes with beta-actin ( β-actin ) and 18S ribosomal RNA ( 18s rRNA ) used as reference genes.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

C24:0 avoids cold exposure-induced oxidative stress and fatty acid β-oxidation damage

2021

Self Cite

View full text Add to dashboard Cite

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

C24:0 avoids cold exposure-induced oxidative stress and fatty acid β-oxidation damage

2021

Self Cite

View full text Add to dashboard Cite

“…In vitro transcription of Cas9 RNA and gRNA were based on the standards of the relevant research [54]. Detailed construction methods were performed as previously described [55]. The genomic DNA was isolated from six randomly selected fertilized embryos.…”

Section: Elovl8a and Elovl8b Gene Knockout By Crispr/cas9 In Zebrafishmentioning

confidence: 99%

Evolution and Functional Characteristics of the Novel elovl8 That Play Pivotal Roles in Fatty Acid Biosynthesis

Sun

Wang

Goh

et al. 2021

Genes

Self Cite

View full text Add to dashboard Cite

Elongation of very long-chain fatty acid (Elovl) proteins are key enzymes that catalyze the rate-limiting step in the fatty acid elongation pathway. The most recently discovered member of the Elovl family, Elovl8, has been proposed to be a fish-specific elongase with two gene paralogs described in teleosts. However, the biological functions of Elovl8 are still to be elucidated. In this study, we showed that in contrast to previous findings, elovl8 is not unique to teleosts, but displays a rather unique and ample phylogenetic distribution. For functional determination, we generated elovl8a (elovl8a−/−) and elovl8b (elovl8b−/−) zebrafish using CRISPR/Cas9 technology. Fatty acid composition in vivo and zebrafish liver cell experiments suggest that the substrate preference of Elovl8 overlapped with other existing Elovl enzymes. Zebrafish Elovl8a could elongate the polyunsaturated fatty acids (PUFAs) C18:2n-6 and C18:3n-3 to C20:2n-6 and C20:3n-3, respectively. Along with PUFA, zebrafish Elovl8b also showed the capacity to elongate C18:0 and C20:1. Gene expression quantification suggests that Elovl8a and Elovl8b may play a potentially important role in fatty acid biosynthesis. Overall, our results provide novel insights into the function of Elovl8a and Elovl8b, representing additional fatty acid elongases not previously described in chordates.

show abstract

“…The synthesis and purification of cas9 RNA and gRNA were performed based on the methods described by our previous study [51]. The oligonucleotides were synthesized by TsingKe Biological Technology (Wuhan, China) (Oligo-F: TGTAATACGACTCACTATATACGCTGCCTGCATACTCGGGTTTTAGAGCTAGAAAT; Oligo-R: AAAGCACCGACTCGGTGCCA).…”

Section: Generation Of Elovl6mentioning

confidence: 99%

“…The gene expression level was normalized towards the mean of the two reference genes (gapdh and β-Actin), and the relative expression was calculated with the comparative Ct method (2 ( −∆∆Ct )). The procedures of qPCR reaction were described by Zhao et al [51]. qPCR primers are shown in Table S8.…”

Section: Rna Extraction and Quantitative Pcr (Qpcr) Analysismentioning

confidence: 99%

Quantitative Phosphoproteomic Analysis Reveals the Regulatory Networks of Elovl6 on Lipid and Glucose Metabolism in Zebrafish

Wang

Sun

Cao

et al. 2020

IJMS

Self Cite

View full text Add to dashboard Cite

Elongation of very long-chain fatty acids protein 6 (Elovl6) has been reported to be associated with clinical treatments of a variety of metabolic diseases. However, there is no systematic and comprehensive study to reveal the regulatory role of Elovl6 in mRNA, protein and phosphorylation levels. We established the first knock-out (KO), elovl6−/−, in zebrafish. Compared with wild type (WT) zebrafish, KO presented significant higher whole-body lipid content and lower content of fasting blood glucose. We utilized RNA-Seq, tandem mass tag (TMT) labeling-based quantitative technology and liquid chromatography-tandem mass spectrometry (LC-MS/MS) to perform the transcriptomic, proteomic and phosphoproteomic analyses of livers from WT and elovl6−/− zebrafish. There were 734 differentially expressed genes (DEG) and 559 differentially expressed proteins (DEP) between elovl6−/− and WT zebrafish, identified out of quantifiable 47251 transcripts and 5525 proteins. Meanwhile, 680 differentially expressed phosphoproteins (DEPP) with 1054 sites were found out of quantifiable 1230 proteins with 3604 sites. Gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) analysis of the transcriptomic and proteomic data further suggested that the abnormal lipid metabolism and glucose metabolism in KO were mainly related to fatty acid degradation and biosynthesis, glycolysis/gluconeogenesis and PPAR signaling pathway. Based on phosphoproteomic analyses, some kinases critical for lipid metabolism and glucose metabolism, including ribosomal protein S6 kinase (Rps6kb), mitogen-activated protein kinase14 (Mapk14) and V-akt murine thymoma viral oncogene homolog 2-like (Akt2l), were identified. These results allowed us to catch on the regulatory networks of elovl6 on lipid and glucose metabolism in zebrafish. To our knowledge, this is the first multi-omic study of zebrafish lacking elovl6, which provides strong datasets to better understand many lipid/glucose metabolic risks posed to human health.

show abstract

n-3 PUFA reduction caused by fabp2 deletion interferes with triacylglycerol metabolism and cholesterolhomeostasis in fish

Cited by 18 publications

References 47 publications

C24:0 avoids cold exposure-induced oxidative stress and fatty acid β-oxidation damage

C24:0 avoids cold exposure-induced oxidative stress and fatty acid β-oxidation damage

Evolution and Functional Characteristics of the Novel elovl8 That Play Pivotal Roles in Fatty Acid Biosynthesis

Quantitative Phosphoproteomic Analysis Reveals the Regulatory Networks of Elovl6 on Lipid and Glucose Metabolism in Zebrafish

Contact Info

Product

Resources

About