Nanoliter Segmented-Flow Sampling Mass Spectrometry with Online Compartmentalization

Abstract

We report a microfluidic device, using segmented flow in a two-phase system of immiscible liquids, which delivers aqueous droplets into a modified commercial mass spectrometer. The interface coupling the microfluidics to the mass spectrometer achieves up to 96% sample transfer efficiency to the vacuum chamber. Sample ionization is assisted by multipass infrared laser beam in the interface. The system achieves low femtomole detection limits of several analytes ranging from drugs to proteins. Sample ionization in this segmented-flow sampling was found to be remarkably insensitive to the presence of buffer salts and other matrices.

Induction based fluidics (IBF) for droplet‐based mass spectrometric analysis of oligonucleotides

“…The mass spectrum obtained when summing across the entire acquisition window (Fig. (b)) illustrates one advantage of pulsed operation wherein the background is significantly reduced . The intervals between droplet arrival in the mass analyzer are characterized by no background, which can be reflected in the summed mass spectral data.…”

“…1(b)) illustrates one advantage of pulsed operation wherein the background is significantly reduced. [14,15] The intervals between droplet arrival in the mass analyzer are characterized by no background, which can be reflected in the summed mass spectral data. This feature is illustrated further by examining the mass spectrum obtained from a single droplet ( Fig.…”

“…As solvent surface tension, dielectric constant and vapor pressure affect droplet charging and desolvation, several common solution conditions for oligonucleotide samples were examined. A 5 pmol/μl sample of dT 15 was prepared in organic : aqueous solutions ranging from 10% to 90% organic solvent using methanol, isopropanol and acetonitrile. The signal response was determined by deconvoluting the multiply charged mass spectral data and recording the abundance of the dT 15 molecular ion.…”

“…Induction-based fluidic was also appropriate for the analysis of low concentration solutions of oligonucleotides. Figure 3(a) shows representative mass spectral results from a 5 pmol/μl solution of dT 15 , and results from a 100 fmol/μl concentration of dT 15 are seen in Fig. 3(b).…”

“…Oligonucleotides, dT 15 CGGCGGTGGCGGCTGTTGCT (20-mer-HG, MW 6194.0 Da), were purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA). Mass spectrometry grade water and methanol were purchased from Honeywell B&J (Muskegon, MI, USA).…”