Neuronal Restrictive Silencing Element Is Found in the KCC2 Gene: Molecular Basis for KCC2-Specific Expression in Neurons

Karadsheh, M.; Delpire, Eric

doi:10.1152/jn.2001.85.2.995

Cited by 50 publications

(46 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Indeed, the region where BNIP3 binds contains a sequence that is homologous to a consensus repressor signal for neural-specific genes (Karadsheh and Delpire, 2001). Novel mechanisms have also been proposed for the function of other Bcl-2 family members in the nucleus (Zinkel et al, 2007).…”

Section: Discussionmentioning

confidence: 99%

BNIP3 (Bcl-2 19 kDa Interacting Protein) Acts as Transcriptional Repressor of Apoptosis-Inducing Factor Expression Preventing Cell Death in Human Malignant Gliomas

Burton¹,

Eisenstat²,

Gibson³

2009

J. Neurosci.

View full text Add to dashboard Cite

The Bcl-2 19 kDa interacting protein (BNIP3) is a pro-cell-death BH3-only member of the Bcl-2 family. We previously found that BNIP3 is localized to the nucleus in the majority of glioblastoma multiforme (GBM) tumors and fails to induce cell death. Herein, we have discovered that nuclear BNIP3 binds to the promoter of the apoptosis-inducing factor (AIF) gene and represses its expression. BNIP3 associates with PTB-associating splicing factor (PSF) and HDAC1 (histone deacetylase 1) contributing to transcriptional repression of the AIF gene. This BNIP3-mediated reduction in AIF expression leads to decreased temozolomide-induced apoptosis in glioma cells. Furthermore, nuclear BNIP3 expression in GBMs correlates with decreased AIF expression. Together, we have discovered a novel transcriptional repression function for BNIP3 causing reduced AIF expression and increased resistance to apoptosis. Thus, nuclear BNIP3 may confer a survival advantage to glioma cells and explain, in part, why BNIP3 is expressed at high levels in solid tumors, especially GBM.

show abstract

Section: Discussionmentioning

confidence: 99%

BNIP3 (Bcl-2 19 kDa Interacting Protein) Acts as Transcriptional Repressor of Apoptosis-Inducing Factor Expression Preventing Cell Death in Human Malignant Gliomas

Burton¹,

Eisenstat²,

Gibson³

2009

J. Neurosci.

View full text Add to dashboard Cite

show abstract

“…However, it is known that neuron-restricted expression pattern in KCC2 is at least due in part to the presence of a neuronal-restrictive silencing element (NRSE). A genomic clone containing ϳ7 kb of KCC2 5Ј-flanking region, exon 1, and ϳ11 kb of downstream sequence revealed that mouse KCC2 gene contains the sequence TTCAGCACCACGGACAGCGCC within intron 1 (205). This sequence was also observed within intron 1 in humans (380) and is 80% homologous to consensus site for a neuronal-restrictive silencing factor binding (NRSF).…”

Section: The K ϩ -Coupled Chloride Cotransportersmentioning

confidence: 99%

“…Mouse putative NRSE contains four mismatched nucleotides when compared with classical NRSE; however, three have been previously shown to be nonessential for NRSF binding (360). In addition, Karadsheh and Delpire (205) observed that the 21-bp fragment containing the putative NRSE was able to interact with proteins isolated from C17 nonneuronal cells and that addition of cold NRSE fragment displaced the binding. In addition, in a luciferase gene reported assay carried out in C17 cells, investigators observed that luciferase activity yielded by KCC2 promoter alone was completely prevented with KCC2 promoter construct also containing NSRE sequence.…”

Section: The K ϩ -Coupled Chloride Cotransportersmentioning

confidence: 99%

See 1 more Smart Citation

Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters

Gamba

2005

Physiological Reviews

705

754

View full text Add to dashboard Cite

Electroneutral cation-Cl−cotransporters compose a family of solute carriers in which cation (Na+or K+) movement through the plasma membrane is always accompanied by Cl−in a 1:1 stoichiometry. Seven well-characterized members include one gene encoding the thiazide-sensitive Na+−Cl−cotransporter, two genes encoding loop diuretic-sensitive Na+−K+−2Cl−cotransporters, and four genes encoding K+−Cl−cotransporters. These membrane proteins are involved in several physiological activities including transepithelial ion absorption and secretion, cell volume regulation, and setting intracellular Cl−concentration below or above its electrochemical potential equilibrium. In addition, members of this family play an important role in cardiovascular and neuronal pharmacology and pathophysiology. Some of these cotransporters serve as targets for loop diuretics and thiazide-type diuretics, which are among the most commonly prescribed drugs in the world, and inactivating mutations of three members of the family cause inherited diseases such as Bartter's, Gitelman's, and Anderman's diseases. Major advances have been made in the past decade as consequences of molecular identification of all members in this family. This work is a comprehensive review of the knowledge that has evolved in this area and includes molecular biology of each gene, functional properties of identified cotransporters, structure-function relationships, and physiological and pathophysiological roles of each cotransporter.

show abstract

“…These changes in functional expression are believed in part to be transcriptional (11,12), but post-translational modification of KCC2 is also likely to be of central importance. Intriguingly the activity of a number of protein kinases, including WNK3, WNK4, brain-type creatine kinase, TrkB receptors, tyrosine kinases, and PKC, have all been reported to influence KCC2 activity (13).…”

mentioning

confidence: 99%

Direct Protein Kinase C-dependent Phosphorylation Regulates the Cell Surface Stability and Activity of the Potassium Chloride Cotransporter KCC2

Lee

Walker

Williams

et al. 2007

Journal of Biological Chemistry

264

326

View full text Add to dashboard Cite

The potassium chloride cotransporter KCC2 plays a major role in the maintenance of transmembrane chloride potential in mature neurons; thus KCC2 activity is critical for hyperpolarizing membrane currents generated upon the activation of ␥-aminobutyric acid type A and glycine (Gly) receptors that underlie fast synaptic inhibition in the adult central nervous system. However, to date an understanding of the cellular mechanism that neurons use to modulate the functional expression of KCC2 remains rudimentary. Using Escherichia coli expression coupled with in vitro kinase assays, we first established that protein kinase C (PKC) can directly phosphorylate serine 940 (Ser 940) within the C-terminal cytoplasmic domain of KCC2. We further demonstrated that Ser 940 is the major site for PKC-dependent phosphorylation for full-length KCC2 molecules when expressed in HEK-293 cells. Phosphorylation of Ser 940 increased the cell surface stability of KCC2 in this system by decreasing its rate of internalization from the plasma membrane. Coincident phosphorylation of Ser 940 increased the rate of ion transport by KCC2. It was further evident that phosphorylation of endogenous KCC2 in cultured hippocampal neurons is regulated by PKC-dependent activity. Moreover, in keeping with our recombinant studies, enhancing PKC-dependent phosphorylation increased the targeting of KCC2 to the neuronal cell surface. Our studies thus suggest that PKC-dependent phosphorylation of KCC2 may play a central role in modulating both the functional expression of this critical transporter in the brain and the strength of synaptic inhibition. Cation-chloride cotransporters (CCC)3 regulate Cl Ϫ homeostasis in cells and the generation of transmembrane chloride gradients (1). Adult mammalian neurons maintain low intracellular Cl Ϫ concentrations, which arise principally from the activity of the potassium chloride cotransporter-2 (KCC2). The maintenance of such low levels of intracellular Cl Ϫ ions is responsible for hyperpolarizing Cl Ϫ currents upon activation of GABA A and Gly receptors, which are responsible for fast synaptic inhibition in the adult central nervous system (2-5). Molecular studies have demonstrated that KCC2 is a member of a CCC superfamily and that these transporters are composed of 12-transmembrane domains with N-and C-terminal cytoplasmic domains (2, 6, 7). KCC2 is expressed exclusively in neurons throughout the adult brain. Developmentally KCC2 is first detected around 10 days in vitro in cultured rat neurons, which is coincident with the emergence of hyperpolarizing GABA A receptor-mediated Cl Ϫ currents (4, 8). Gene knock-out of KCC2 has revealed that ablating the expression of this protein results in early postnatal death. Neurons derived from these animals exhibit compromised GABA A receptor-mediated synaptic inhibition (9).Under pathological conditions such as epilepsy or ischemic brain injury, deficits in the expression of KCC2 are evident together with decreased efficacy of GABAergic inhibition and with the emergence of depola...

show abstract

Neuronal Restrictive Silencing Element Is Found in the KCC2 Gene: Molecular Basis for KCC2-Specific Expression in Neurons

Cited by 50 publications

References 16 publications

BNIP3 (Bcl-2 19 kDa Interacting Protein) Acts as Transcriptional Repressor of Apoptosis-Inducing Factor Expression Preventing Cell Death in Human Malignant Gliomas

BNIP3 (Bcl-2 19 kDa Interacting Protein) Acts as Transcriptional Repressor of Apoptosis-Inducing Factor Expression Preventing Cell Death in Human Malignant Gliomas

Molecular Physiology and Pathophysiology of Electroneutral Cation-Chloride Cotransporters

Direct Protein Kinase C-dependent Phosphorylation Regulates the Cell Surface Stability and Activity of the Potassium Chloride Cotransporter KCC2

Contact Info

Product

Resources

About