New Multiplex PCR for Rapid Detection of Isoniazid-Resistant Mycobacterium tuberculosis Clinical Isolates

Abstract

In this study, we describe a multiplex PCR to detect a AGC3ACC (serine to threonine) mutation in the katG gene and a ؊15 C-to-T substitution (inhA C؊15T Currently, throughout the world, isoniazid (INH) and rifampin (RIF) together represent the backbone of short-course chemotherapy for Mycobacterium tuberculosis infections. The number of multidrug-resistant strains of M. tuberculosis, defined as resistant to INH and RIF, has been increasing over the years, and several outbreaks have been reported (5, 9, 24). The development of resistance to these two drugs reduces the efficacy of standard antituberculosis (anti-TB) treatment to 77%. It is very important, therefore, to identify these strains as soon as possible to allow for adjustments in treatment and to minimize the transmission of drug-resistant strains. Phenotypic drug susceptibility testing by conventional methods on solid media (6, 8) requires 10 to 30 days after the primary culture has been isolated. This time can be reduced by the use of rapid methods such as BACTEC, which requires 5 to 10 days.)Resistance to RIF has been shown to be caused by an alteration of the ␤ subunit of RNA polymerase, which is encoded by the rpoB gene. More than 95% of RIF-resistant strains are associated with mutations within an 81-bp region of the rpoB gene (encoding the RNA polymerase ␤ subunit). Specific mutations, insertions, and deletions have been described in several countries by several authors, and this 81-bp region has been termed the rifampin resistance determinant region (7,14,20,26,27,30). Numerous methods exist to detect resistance to rifampin (10,12,18,23).In contrast, resistance to INH is more complicated, as mutations in several genes can lead to drug resistance. For most INH-resistant strains, mutations have been found in two genes, i.e., the katG gene, encoding catalase-peroxidase (31), and the mabA-inhA regulon (4), encoding a target of activated prodrug, enoyl-acyl carrier protein reductase (1-3, 11, 13, 15, 17, 21, 27). For some other INH-resistant strains, however, mutations in the ahpC promoter region (located in the 105-bp oxyR-ahpC intergenic region) or within the ␤-ketocyl acyl carrier protein synthase gene kasA have also been reported (19,25). Most studies have examined the mutations present in these genes by DNA sequencing or analyses of a portion of the katG gene after PCR amplification and digestion with the restriction enzyme MspI or SatI (2, 3, 17).Molecular methods have been developed to detect resistance to INH and RIF as an alternative to conventional tests because of their ability to provide results rapidly. Upon the elucidation of the genes involved in resistance to RIF and INH, several studies describing various PCR-based molecular genetic techniques for the detection of resistance were published (12).In the present study, we report a simple, rapid, and inexpensive assay based on allele-specific PCR methodology targeting an AGC3ACC mutation in the katG gene and an inhA CϪ15T mutation in the regulatory region of the mabA-inhA operon to detect...

Improved rapid molecular diagnosis of multidrug-resistant tuberculosis using a new reverse hybridization assay, REBA MTB-MDR

“…PCR-based methods with readouts including line probe assays, analysis with DNA microarrays and real-time PCR have been the focus of much recent effort in developing molecular DST methods to determine resistance to RIF and INH (Cirillo et al, 2004;Edwards et al, 2001;El-Hajj et al, 2001;Herrera-Leó n et al, 2005;van Doorn et al, 2003). Among the most successful of these molecular diagnostic methods is the GenoType MTBDRplus assay (Hain LifeScience), which is based on reverse hybridization of amplicons containing rpoB, katG and inhA from test strains to probes carrying specific mutations in these genes.…”

Determinación de la mutación S315T del gen katG en aislados resistentes a Isoniacida de Mycobacterium tuberculosis mediante PCR-RFLP

“…Estos resultados difieren de trabajos previos publicados en los cuales solo se reporta la presencia de perfiles de mutación en la posición S315T en aislados resistentes 7,19,20,22,31 , el 25,5% de aislados fenotipicamente resistentes que no presentaron la mutación estudiada, pudo deberse a la presencia de polimorfismos en regiones diferente a la posición S315T [15][16][17][18][19][20] en el gen katG u otros genes que aporten resistencia a Isoniacida 9-14 indiciendo a la sobreexpresión que superen el poder inhibitorio de INH 26,31 ; otra causa puede ser la presencia de mecanismos de resistencia diferente a las mutaciones tales como mecanismos de barrera (reducción de la permeabilidad 32-33 y bomba de eflujo [34][35][36][37] ). En cuanto a la presencia de un aislado sensible con la mutación S315T, posiblemente se deba a que el límite de la detección por PCR-RFLP empleada se encuentre cercano al 1% de resistentes que basado en el método de las proporciones pasa imperceptible y se considera como sensible, tambien podría deberse a una inadecuada identificación del perfil de resistencia mediante la prueba de las proporciones en el aislado sensible, y/o contaminación del aislado después de su conservación.…”

“…Para determinar el polimorfismo de la región 315 del gen katG, dos productos fueron amplificados por reacción en cadena de la polimerasa (PCR) con los iniciadores katG500fUT1 5´ACCCAACTGAATGGAGCATGGGCGGAC3´ (1054 pb), katG904: 5-AGCTCGTATGGCACCGGAAC-3 (630 pb), respectivamente y katG1533rUT2: 5-ACGCACTTGACTTGTCTTCGTCGGGGTCGT-GACCTCCCA-3 (modificado de Herrera-León et al 20 ) los cuales reconocen una región circundante del codón 315. Las amplificaciones se realizaron en un volumen de reacción final de 50µL conteniendo 1X de GoTaq Colorless Master Mix (Promega, Madison, WI 53711 USA) el cual contiene Taq DNA Polimerasa, 400µM dNTPs y 3mM MgCl 2, 0,25 µM de cada iniciador y 150 ng de ADN extraído.…”

“…La INH actúa inhibiendo la biosíntesis de los ácidos micólicos de la pared celular, e ingresa en el Mycobacterium tuberculosis como un profárma-co por difusión pasiva y es activada por la enzima catalasaperoxidasa codificada por katG, para generar radicales libres, que atacan a continuación múltiples objetivos en las células 8 . Se ha reportado en varios estudios que la resistencia a isoniacida está relacionada con mutaciones específicas en varios genes importantes de Mycobacterium tuberculosis, existiendo variantes genéticas tales como: katG (S315T, S315N, S315D, S315I, S315R, V61G, Q247H, A62T, G383A, C701G, G1388T), inhA (S94A, I21V, I21T, I47T, I194T, 3, 258, 190) y su región promotora (-15 C-T, -8 T-C, T-A ó T-G,-17 G-T), ahpC, nhd, kasA, oxyR, furA, fabG1 [9][10][11][12][13][14][15][16][17][18][19][20][21] , de igual manera, se ha podido mostrar que la aplicación de PCR-RFLP del gen katG permite la identificación eficiente de aislados resistentes a isoniacida pudiendo emplearse como una prueba rápida de detección [22][23][24][25] .…”

Identificazione molecolare di mutazioni conferenti resistenza a rifampicina ed isoniazide in M. tuberculosis in campioni clinici diretti mediante Genotype MTBDR (Hain Lifescience)

“…Le mutazioni a carico del codone 315 del gene katG rappresentano il 60-80% dei casi INH-resistenti (INH-R). Sono state identificate mutazioni anche nelle regioni regolatorie di inhA e ahpC-oxyR (3,9,11). L'analisi di ceppi di MTB INH-R isolati in diver-si Paesi ha dimostrato che la prevalenza di tali mutazioni varia su scala geografica (16).…”