Nitric oxide maintains cell survival of Trichomonas vaginalis upon iron depletion

Abstract

BackgroundIron plays a pivotal role in the pathogenesis of Trichomonas vaginalis, the causative agent of highly prevalent human trichomoniasis. T. vaginalis resides in the vaginal region, where the iron concentration is constantly changing. Hence, T. vaginalis must adapt to variations in iron availability to establish and maintain an infection. The free radical signaling molecules reactive oxygen species (ROS) and reactive nitrogen species (RNS) have been proven to participate in iron deficiency in eukaryotes. However, little is known about the roles of these molecules in iron-deficient T. vaginalis.MethodsT. vaginalis cultured in iron-rich and -deficient conditions were collected for all experiments in this study. Next generation RNA sequencing was conducted to investigate the impact of iron on transcriptome of T. vaginalis. The cell viabilities were monitored after the trophozoites treated with the inhibitors of nitric oxide (NO) synthase (L-NG-monomethyl arginine, L-NMMA) and proteasome (MG132). Hydrogenosomal membrane potential was measured using JC-1 staining.ResultsWe demonstrated that NO rather than ROS accumulates in iron-deficient T. vaginalis. The level of NO was blocked by MG132 and L-NMMA, indicating that NO production is through a proteasome and arginine dependent pathway. We found that the inhibition of proteasome activity shortened the survival of iron-deficient cells compared with untreated iron-deficient cells. Surprisingly, the addition of arginine restored both NO level and the survival of proteasome-inhibited cells, suggesting that proteasome-derived NO is crucial for cell survival under iron-limited conditions. Additionally, NO maintains the hydrogenosomal membrane potential, a determinant for cell survival, emphasizing the cytoprotective effect of NO on iron-deficient T. vaginalis. Collectively, we determined that NO produced by the proteasome prolonged the survival of iron-deficient T. vaginalis via maintenance of the hydrogenosomal functions.ConclusionThe findings in this study provide a novel role of NO in adaptation to iron-deficient stress in T. vaginalis and shed light on a potential therapeutic strategy for trichomoniasis.Electronic supplementary materialThe online version of this article (doi:10.1186/s13071-015-1000-5) contains supplementary material, which is available to authorized users.

Trichomoniasis – are we giving the deserved attention to the most common non-viral sexually transmitted disease worldwide?

“…Glucose restriction elicits trichomonads antioxidant ability and autophagy to maintain survival trough a metabolic reprogramming. In the same way, nitric oxide exerts a cytoprotective effect on iron-deficient T. vaginalis by maintaining the hydrogenosomal membrane potential 146. Furthermore, the transcription of iron-regulated and iron-independent gene copies was analyzed and multiple gene copies were shown to be advantageous for the parasite to differentially express genes and proteins under stringent regulation in variable environmental conditions 147.…”

Protein cysteine S-nitrosylation provides reducing power by enhancing lactate dehydrogenase activity in Trichomonas vaginalis under iron deficiency

“…Hydrogenosomal energy metabolism was found to be signi cantly reduced by iron limitation, suggesting that enhanced glycolysis may be a compensatory mechanism for energy production in T. vaginalis [7]. In our previous RNA-Seq analysis, the expression of glycolytic enzymes did not differ between iron-rich (IR) and iron-depleted (ID) conditions (Additional le 2) [16]. To clarify whether glycolysis is affected by iron availability, lactate production was measured following previous studies [27,28].…”

“…vaginalis (ATCC_30236) was used in this study. An iron-de cient (ID) group of T. vaginalis was established by the addition of 180 M dipyridyl (DIP, Sigma Aldrich, Merck, Germany) to yeast extract, iron-serum (YI-S) medium at a density of ~1 × 10 6 /ml, and an iron-rich (IR) cell group was established using YI-S medium containing ferrous ammonium citrate (FAC) [16]. To create a nitrate treatment for the ID cells, sodium nitrate (25 mM, Sigma Aldrich, Merck) was added at the same time DIP was added.…”

“…The total RNA of T. vaginalis cultured under iron-rich and -de cient conditions was extracted for determining the expression levels of TvLDHs [16]. Brie y, the cell pellets were resuspended in TRI Reagent Solution (Invitrogen, Thermo Fisher Scienti c, USA) and incubated at RT for 5 min.…”

“…The cDNA was then subjected to real-time polymerase chain reaction (real-time PCR). Ribosomal protein L8 (TVAG_104490) was used as the internal control for data normalization (forward: TTGCGGTATCAAGATGAACCCAG, reverse: GAACCAAAGCTTTATGCAAGGTGA) [16]. The reaction mixture contained cDNA, TOOLS 2× SYBR qPCR mix (Biotools, Taiwan), and speci c primer sets (Additional le 1), and the reaction was performed using a QuantStudio 3 instrument (Applied Biosystems, Thermo Fisher Scienti c, USA).…”