Novel missense mutation in the FH gene in familial renal cell cancer patients lacking cutaneous leiomyomas

Kuwada, Masaomi; Chihara, Yoshitomo; Liu, Yi; Torimoto, Kazumasa; Kagebayashi, Yoriaki; Takagi, Kenji; Shuin, Taro; Fujimoto, Kiyohide; Kuniyasu, Hiroki; Samma, Shoji

doi:10.1186/1756-0500-7-203

Cited by 14 publications

(18 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Although the case did not meet the clinical diagnostic criteria of HLRCC, cumulative information of renal histopathology after the patient's death made us investigate the possibility of FH mutation. Five previously reported Japanese families with HLRCC exhibited different mutations, including four missense mutations and a splice site mutation that have not been reported in Caucasian families . These mutations together with the novel mutation pattern detected in the current case indicate the existence of several founders in Japan harboring FH mutations distinct from those detected in Caucasian families.…”

Section: Discussionsupporting

confidence: 47%

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Matsumoto

Udaka

Hasumi

et al. 2018

Pathology International

View full text Add to dashboard Cite

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

show abstract

Section: Discussionsupporting

confidence: 47%

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Matsumoto

Udaka

Hasumi

et al. 2018

Pathology International

View full text Add to dashboard Cite

show abstract

“…In the Japanese population, only four FH mutations have been reported in the published work . We herein identified a Japanese male patient with multiple cutaneous leiomyomas and found a novel heterozygous splice site mutation in the FH gene.…”

Section: Introductionmentioning

confidence: 83%

Novel splice site mutation in the fumarate hydratase (FH) gene is associated with multiple cutaneous leiomyomas in a Japanese patient

Yoshinaga

Nakai

Ito

et al. 2015

The Journal of Dermatology

View full text Add to dashboard Cite

Cutaneous leiomyoma is a benign skin tumor that originates from the smooth muscle, such as the arrector pili muscle of the hair follicles. Familial cases with multiple cutaneous leiomyomas exist, which typically show an autosomal dominant inheritance trait. Most patients with the disease are known to carry heterozygous germ line mutations in the fumarate hydratase (FH) gene and can be complicated by tumors in internal organs, especially uterine leiomyoma and renal cell cancer in high frequency. In this study, we identified a Japanese male patient with multiple cutaneous leiomyomas and found a novel heterozygous splice site mutation, c.738 + 2T>A, in the FH gene of the patient, which was unexpectedly inherited from his unaffected father. Further analysis demonstrated loss of heterozygosity in the tumor tissue, which resulted in a hemizygote state of the mutant allele. Expression studies with the tumor tissue showed that the mutation led to skipping of exon 5 at mRNA levels, which was predicted to cause an in-frame deletion of FH protein (p.Ser186_Gln246del). The protein structure analysis strongly suggested that the deletion would severely disrupt the conformation of the FH protein including the substratebinding domain, and thus would severely affect the expression and the function. Our findings further disclose the molecular basis of multiple cutaneous leiomyomas and also provide precious information to the mutation carriers in the family for an early diagnosis of renal cell cancer in the future.

show abstract

“…References with number of patients between brackets: [1] (1), [13] (9), [17] (1), [2, 3] (1), [18] (12), [4] (37), [19] (1), [20] (2), [21] (1), [22] (1), [23] (3), [24] (1), [25] (1), [6] (1), [16] (25), [26] (1), [27] (1), [28] (1), [29] (1) [30] (2)…”

Section: Figurementioning

confidence: 99%

Hereditary leiomyomatosis and renal cell cancer (HLRCC): renal cancer risk, surveillance and treatment

et al. 2014

View full text Add to dashboard Cite

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is an autosomal dominant condition in which susceptible individuals are at risk for the development of cutaneous leiomyomas, early onset multiple uterine leiomyomas and an aggressive form of type 2 papillary renal cell cancer. HLRCC is caused by germline mutations in the fumarate hydratase (FH) gene, which inactivates the enzyme and alters the function of the tricarboxylic acid (TCA/ Krebs) cycle. Issues surrounding surveillance and treatment for HLRCC-associated renal cell cancer were considered as part of a recent international symposium on HLRCC. The management protocol proposed in this article is based on a literature review and a consensus meeting. The estimated lifetime renal cancer risk for FH mutation carriers is estimated to be 15%. In view of the potential for early onset of RCC in HLRCC, periodic renal imaging and, when available, predictive testing for a FH mutation is recommended from 8 to 10 years of age. However, the small risk of renal cell cancer in the 10-20 years age range and the potential drawbacks of screening should be carefully discussed on an individual basis. Surveillance preferably consists of annual abdominal MRI. Treatment of renal tumours should be prompt and generally consist of wide-margin surgical excision and consideration of retroperitoneal lymph node dissection. The choice for systemic treatment in metastatic disease should, if possible, be part of a clinical trial. Screening procedures in HLRCC families should preferably be evaluated in large cohorts of families.

show abstract

Novel missense mutation in the FH gene in familial renal cell cancer patients lacking cutaneous leiomyomas

Cited by 14 publications

References 16 publications

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Novel splice site mutation in the fumarate hydratase (FH) gene is associated with multiple cutaneous leiomyomas in a Japanese patient

Hereditary leiomyomatosis and renal cell cancer (HLRCC): renal cancer risk, surveillance and treatment

Contact Info

Product

Resources

About