Nucleotide excision repair gene function in short-sequence recombination

Abstract

Mutations in several nucleotide excision repair genes were found to affect the efficiency of recombination between short DNA sequences in Saccharomyces cerevisiae. These effects could be due to observed changes in the processing of recombination intermediates.Yeast (Saccharomyces cerevisiae) strains carrying mutant ura3 genes were transformed with DNA fragments containing the wild-type URA3 gene flanked by 36 to 866 bp of DNA homologous to the yeast HIS3 gene (Fig. 1). Only two types of Ura ϩ transformants were obtained: those resulting from DNA fragment integration into the HIS3 locus and those in which genomic ura3 sequences were restored to the wild type by either integration or gene conversion. We did not find URA3 sequences associated with any other locus (data not shown). As expected, the percentage of transformants of each type was dependent on the length of the HIS3 sequences at the end of the DNA fragment ( Fig. 1 and 2). The longer the length of HIS3 DNA, the higher the percentage of integrations at the HIS3 locus; however, the efficiency of recovery of Ura ϩ recombinants did not substantially change (Fig. 1). As in previous studies (3,11,13,20), we found that shorter HIS3 sequences resulted in fewer insertions into the HIS3 locus per unit length than longer sequences ( Fig. 1 and 2). This suggests that there is a mechanism for the suppression of recombination between sequences that have short lengths of homology.FIG. 1. Assay of recombination between DNA fragments and the genome. All substrates contained the URA3 gene (no shading) on a 1.2-kb DNA fragment. The first substrate consisted of the URA3 gene alone. The next five substrates consisted of the URA3 gene flanked by HIS3 DNA (shaded black; lengths in base pairs). The last three substrates contained 10, 20, and 30 bp, respectively, of heterologous (not homologous to the yeast genome) DNA (stippled) on both sides of the shortest HIS3 flanks. All strains were isogenic and contained wild-type (Wt) HIS3 and mutant ura3-1 alleles. The rad3-G595R (3) and rad1::LEU2 (23) strains were previously described. The rad3-20, rad2::TRP1, and rad10::LEU2 alleles were introduced by transformation. The transformation efficiency with the URA3-containing fragments (U ϩ ) was determined by dividing the number of Ura ϩ transformants obtained per microgram of DNA by the number of viable cells that were plated. The ranges from three independent determinations were reported. All Ura ϩ transformants were scored by replica plating for growth in the absence of histidine.

Novel Function of Rad27 (FEN-1) in Restricting Short-Sequence Recombination

“…Similar to recombination in the rad3, ssl1, and ssl2 mutants described previously (2,3,29,34), SSR was stimulated severalfold in the rad27-null mutant, while recombination between long sequences was unaffected.…”

“…Previously, it was shown that Rad2, a NER endonuclease (13,20), does not play a role in SSR (2). Similarly, in this report we describe evidence that Exo1, a 5Ј-3Ј double-stranded exonuclease that plays a role in homologous recombination, mismatch repair, and the repair of UV-damaged DNA (16,41,54,63,66), and Din7, a mitochondrial protein that affects mitochondrial DNA stability (15), do not significantly affect SSR.…”

“…Subsequently, it was shown that Rad1-Rad10 is a structure-specific endonuclease (58,65) that can cleave terminal 3Ј single strands displaced when adjacent sequences pair with homologous sequences on another DNA molecule (6). Rad1 may cleave other intermediates during several different types of recombination events (2,60).…”

“…The primers 5Ј-CAATTAAAGAGAATTCAAAAACAGGTG TCCCTGAAAAAATACATGTATCAAACACGTACGCTGCAGGTCGA C-3Ј and 5Ј-CTCCCTCTCCGATAACACGTCCTGCGTATCCACTAGCGGT TGCTCCACTTTCTTATCGATCAATTCGAGCTCG-3Ј were used to amplify KAN-MX sequences from pFA6a-kanMX4 (68). To construct the his3::ura3:: LEU2 allele, a 2.0-kb HpaI/SmaI LEU2 clone was inserted into StuI-and ApaIdigested pLAY144 (2), bisecting the URA3 gene in the his3::URA3 segment and creating pLAY315. A 3.2-kb HindIII fragment from pLAY315 containing the his3::ura3::LEU2 segment was used to transform W961-5A to leucine prototrophy.…”

“…Recent discoveries suggest a genetic basis for the limitation of short-sequence recombination (SSR) in yeast. Novel mutations in the RAD3, SSL1, and SSL2 genes, which encode components of the nucleotide excision repair (NER) apparatus and transcription factor TFIIH (14,69), disrupt the control of SSR and increase genome rearrangement (2,3,29,34). Genome instability may be due to slow removal of sequences at the ends of broken DNA molecules by an unidentified nuclease or nucleases.…”