Phenotypic, Genotypic Characterisation and Antimicrobial Susceptibility Determination of Lactococcus garvieae Strains

Abstract

SummaryIn this study, phenotypic and genotypic features of 10 L. garvieae strains isolated from rainbow trout farms were examined with 3 reference strains (Spain, England and ATCC 43921) comperativly. Rapid 32 STREP and conventional microbiologic tests were used for determining phenotipic features of L. garvieae strains. Altough there are diff erences, in Rapid 32 STREP system, between strains in terms of β-Glucuronidase, D-ribose, sorbitol, lactose, raffinose, alanyl-phenylalanyl-proline arylamidase, pyrrolidonyl arylamidase, hippurate hydrolysis, urease tests, all strains have been confirmed as L. garvieae by API web. In RAPD PCR analysis, in which ERIC 2 primer is used, L. garvieae isolates were genotyped within 3 separate clusters according to similarity coefficient index of 70%, and it was detected that a vast majority of isolates with Turkey-origin (8 isolates) belongs to predominant type LG1 genotype. In addition to this, antimicrobial tests of L. garvieae strains shows that there are resistance against gentamycin, neomycin, lincomycin, sulfamethoxazole-trimethoprim, oxytetracycline, erythromycin, amoxicillin, fl orfenicol and doxycycline, which are frequently used on fish in our country. Keywords: Oncorhynchus mykiss, Lactococcus garvieae, Rapid32 STREP, RAPD PCR, Antimicrobial sensitivity Lactococcus garvieae Suşlarının Fenotipik, Genotipik Karakterizasyonu ve Antimikrobiyal Duyarlılıklarının Belirlenmesi ÖzetAraştırmada, gökkuşağı alabalığı işletmelerinden izole edilmiş olan 10 adet Lactococcus garvieae suşunun 3 adet referans suşla (İspanya, İngiltere ve ATCC 43921) karşılaştırmalı olarak fenotipik ve genotipik özellikleri incelenmiştir. L. garvieae suşlarının fenotipik özelliklerinin belirlenmesinde konvansiyonel mikrobiyolojik ve Rapid 32 STREP testleri kullanılmıştır. Rapid 32 STREP sistemde suşlar arasında β-Glucuronidase, D-ribose, sorbitol, lactose, raffinose, alanyl-phenylalanyl-proline arylamidase, pyrrolidonyl arylamidase, hippurate hydrolysis, urease testleri yönüyle farklıklar olmasına rağmen API Web'de tüm suşlar L. garvieae olarak doğrulanmıştır. ERIC2 primerinin kullanıldığı RAPD PCR analizinde L. garveae izolatları %70 benzerlik katsayısına göre 3 farklı genotipe ayrılmış ve Türkiye kökenli izolatların büyük bir bölümü (8 izolat) predominant tip olan LG1 genotipine dahil olduğu belirlenmiştir. Ayrıca bu çalışmada L. garvieae suşlarının antibiyotik duyarlılık testlerinde ülkemizde balıklarda sıklıkla kullanılan gentamisin, neomycin, lincomycin, sulphamethoxazoletrimetoprim, oksitetrasiklin, eritromycin, amoxycillin, fl orfenikol ve doksisiklin'e karşı direnç geliştirmiş oldukları belirlenmiştir.

Identification and characterization of lactic acid bacteria isolated from rainbow trout (Oncorhynchus mykiss,Walbaum 1792), with inhibitory activity againstVagococcus salmoninarumandLactococcus garvieae

“…Lactococcosis outbreaks have been regularly observed in rainbow trout since 2001 in Turkey (Avcı, Aydogan, Tanrıkul, & Birincioğlu, ; Diler, Altun, Adıloglu, Kubilay, & Isıklı, ; Tanrikul & Gultepe, ). Therefore, L. garvieae is now considered as one of the most important pathogens in the rainbow trout industry in Turkey (Altun, Onuk, Ciftci, Buyukekiz, & Duman, ). Lactococcosis outbreaks in aquaculture are treated with antibiotics, but these are often ineffective, and their indiscriminate use has led to an increase in antibiotic resistance (Pérez‐Sánchez, Balcázar, Garcia, et al., ; Romalde & Toranzo, ; Vendrell et al., ).…”

Antimicrobial activity oftrans-cinnamic acid and commonly used antibiotics against important fish pathogens and nonpathogenic isolates

“…; Altun et al . ). Rainbow trout is the most commonly aquacultured inland water fish in Turkey (TÜİK ).…”

Untitled

“…AACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAG ************************************************** Previous studies have revealed that L. garvieae strains may have variations in utilisation of hippurate, β-glucuronidase, citrate, Voges-Proskauer (VP), pyrrolidonyl arylamidase, urease, and also in acid production from D-mannose, D-lactose, D-ribose, sorbitol and raffinose (Çağırgan, 2004;Soltani, Nikbakht, Ebrahimzadeh Moussavi, & Ahmadzadeh, 2008;Altun et al, 2013;Didinen, Yardimci, Onuk, Metin, & Yildirim, 2014). Similarly, it has been observed in the present study that isolates were found to have different phenotypic profiles in acid production from ribose and lactose (Table 3).…”

“…This research also indicated isolates previously recorded as resistant to sulphamethoxazole/trimethoprim and susceptible to erythromycin (Diler et al, 2002;Kav & Erganiş, 2007;Raissy & Ansari, 2011;Didinen et al, 2014), to be of intermediate profile. To prevent the emergence of antibiotic resistance and the failure in disease treatment, it should be determined of antibiotic susceptibility profiles of bacteria and applied of suitable antimicrobial agents in sufficient dosage and time (Altun et al, 2013). Pathogenic bacteria which acquire antibiotic resistance continue to survive and maintain the capacity to cause disease.…”

“…Indiscriminate use of antibiotics causes microorganisms to develop antibiotic resistance mechanisms, a potential threat to the environment, as well to aquaculture, and to public health (Vendrell et al, 2006;Austin & Austin, 2012;Altun, Onuk, Ciftci, Büyükekiz, & Duman, 2013;Meyburgh, Bragg, Boucher, 2017). The acquisition of antibacterial resistance in L. garvieae was shown by screening for antibiotic resistance genes (Raissy & Moumeni, 2016;Türe & Alp, 2016).…”