Polymorphisms in the SOD2 and HLA-DRB1 Genes Are Associated with Nonfamilial Idiopathic Dilated Cardiomyopathy in Japanese

Hiroi, Shitoshi; Harada, Haruhito; Nishi, Hirofumi; Satoh, Manatsu; Nagai, Ryozo; Kimura, Akinori

doi:10.1006/bbrc.1999.1036

Cited by 163 publications

(111 citation statements)

References 43 publications

Supporting

Mentioning

102

Contrasting

Unclassified

Order By: Relevance

“…This may be due to alteration of conformation of mitochondrial targeting sequence from α helix (present in those with C allele) to β sheets (present in those with T allele) which leads to reduced import of MnSOD enzyme in to mitochondria and degradation by proteasome. 4,5 Similar findings were found by Hirori et al 4 158 and Robert C.G. Martin et al 5 .…”

Section: Discussionsupporting

confidence: 75%

“…DNA was extracted from buffy coat by high salt method 4 and was used to amplify the 267bp target region in the SOD2 gene by PCR using forward 5'GCTGTGCTTTCTCGTCTTCAG3 'and reverse 5'TGGTACTTCTCCTCGGTGACG3' primers i. Genomic DNA (1μg) was amplified in 25μl reaction mixture containing 5pmol/μL of each primer and Helini master mix containing 100μmol/L of each dNTP, 2.5μL of 10x reaction buffer and 0.6 unit of Taq DNA polymerase. After the DNA was denatured for 5 minutes at 94 o C, the reaction mixture was subjected to 30 cycles of denaturation for one minute at 94 o C, 1 minute of annealing at 60 o C and 1 minute of extension at 72 o C. Final extension was carried over at 72 o C for 10 minutes.…”

Section: Controls :( Group 2)mentioning

confidence: 99%

See 1 more Smart Citation

Susceptibility of diabetics with superoxide dismutase gene 2 polymorphism to cardiovascular complications

2020

IJCBR

View full text Add to dashboard Cite

Introduction: Diabetes mellitus is the most important cause for vascular diseases of heart and brain. The major factor in the development of diabetic complications is oxidative stress. Superoxide dismutases (SODs) are the enzymes which play a primary role against oxidative stress. A polymorphism C/T substitution producing TT genotype in superoxide dismutase 2 gene causes impaired targeting of the SOD 2 enzyme, resulting in reduced activity of the enzyme inside mitochondria. This can lead to increased oxidative stress in these patients making them susceptible to cardiovascular complications Aim: Our study is performed to analyse if there is increased susceptibility of diabetics with SOD2 gene polymorphism to cardiovascular complications and to assess if this SOD2 polymorphism causes reduced SOD activity. Materials and Methods: 30 cases of diabetics with cardiovascular disease, 30 cases of diabetics without cardiovascular disease and 30 healthy controls are included in the study. Genotype analysis by PCR and RFLP and serum superoxide dismutase activity is measured by spectrophotometer. Results: TT genotype is more frequently distributed and Serum SOD activity is reduced among diabetics with CVD compared to diabetics without CVD and controls ,which shows an increased risk of cardiovascular complications among diabetics with SOD2(GCT/GTT) gene polymorphism. Conclusion: TT genotype is an independent risk factor for the development of cardiovascular complications in diabetes. Patients with TT genotype have reduced level of serum superoxide dismutase that may cause increased oxidative stress, the main mechanism for development of cardiovascular complications in diabetes.

show abstract

Section: Discussionsupporting

confidence: 75%

Section: Controls :( Group 2)mentioning

confidence: 99%

Susceptibility of diabetics with superoxide dismutase gene 2 polymorphism to cardiovascular complications

2020

IJCBR

View full text Add to dashboard Cite

show abstract

“…A number of studies have found an association with DR4 (34)(35)(36)(37), although this finding was certainly not universal (38)(39)(40). A lesser number of HLA-association studies included DQ typing (41)(42)(43)(44), and considered together these fail to reach any consensus about the nature of susceptibility alleles.…”

Section: Discussionmentioning

confidence: 99%

Autoimmune cardiomyopathy and heart block develop spontaneously in HLA-DQ8 transgenic IAβ knockout NOD mice

Elliott

Liu

Yuan

et al. 2003

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

A line of nonobese diabetic (NOD) mice expressing the human diabetes-associated HLA-DQ8 transgene in the absence of mouse IA␤ failed to show spontaneous insulitis or diabetes, but rather developed dilated cardiomyopathy, leading to early death from heart failure. Pathology in these animals results from an organ-and cell-specific autoimmune response against normal cardiomyoctes in the atrial and ventricular walls, as well as against very similar myocytes present in the outermost muscle layer surrounding the pulmonary veins. Progression of the autoimmune process could be followed by serial ECG measurements; irradiation of young animals significantly delayed disease progression, and this effect could be reversed by adoptive transfer of splenocytes taken from older animals with complete heart block. Disease progression could also be blocked by cyclosporin A treatment, but was accelerated by injection of complete Fruend's adjuvant. The constellation of findings of spontaneously arising destructive focal lymphocytic infiltrates within the myocardium, rising titers of circulating anticardiac autoantibodies, dilation of the cardiac chambers, and gradual progression to end-stage heart failure bears a striking resemblance to what is seen in humans with idiopathic dilated cardiomyopathy, a serious and often life-threatening medical condition. This transgenic strain provides a highly relevant animal model for human autoimmune myocarditis and postinflammatory dilated cardiomyopathy.I diopathic dilated cardiomyopathy (IDCM) describes a condition whereby previously healthy individuals develop lifethreatening heart failure associated with enlargement of the heart, but with no apparent underlying cause (1, 2). The cardiac pathology seen in the majority of IDCM patients indicates a recent or more long-standing immune-mediated inflammatory process within the muscle tissue of the heart (i.e., myocarditis) (3,4). IDCM patients often demonstrate circulating anticardiac autoantibodies, and the myocarditis is generally thought to arise from an autoimmune response against cardiac tissues (5). Research on IDCM has been hampered by the lack of an appropriate animal model, that is, a model where animals develop disease spontaneously, show severe life-threatening pathology, and display an immunological and histological picture similar to that seen in humans with IDCM.The human MHC class II molecule DQ8 (i.e., haplotype DQA1*0301, DQB1*0302) is known to be associated with type 1 diabetes (T1D). To map DQ8-restricted T cell epitopes for T1D autoantigens we crossed DQ8 transgenic nonobese diabetic (NOD) mice with a NOD MHC class II ␤-chain knockout line (6). Because the resulting animals express the human MHC class II molecule but not the mouse, any CD4 ϩ T cells arising would be restricted to the human MHC molecule. We chose the NOD strain because it is known to have defects in self-tolerance, which we hypothesized would aid our efforts to induce immune responses against self-antigens such as GAD65. Although replacement of the murine T1D-asso...

show abstract

“…The Ala variant at a mitochondrial targeting sequence of SOD2 allows more efficient SOD2 uptake into the mitochondrial matrix and generates more active SOD2 compared with the Val variant, suggesting that Ala/Ala homozygous subjects may have higher SOD2 activity (14)(15)(16). Contrary to this, two small epidemiologic studies on the association between SOD2 polymorphism and prostate cancer showed the Ala variant associated with increased risk of prostate cancer in poorly differentiated prostate cancer cases (17) or men with lower antioxidant intakes (18).…”

Section: Introductionmentioning

confidence: 99%

Functional Variant of Manganese Superoxide Dismutase (SOD2 V16A) Polymorphism Is Associated with Prostate Cancer Risk in the Prostate, Lung, Colorectal, and Ovarian Cancer Study

Kang

Lee

Park

et al. 2007

Cancer Epidemiology, Biomarkers &Amp; Prevention

125

View full text Add to dashboard Cite

Superoxide dismutase (SOD) plays a key role in the detoxification of superoxide free radicals. We evaluated the association of prostate cancer with genetic polymorphisms in SOD1 (CuZn-SOD; IVS3-251A>G), SOD2 [MnSOD; Ex2+24T>C (V16A)], and SOD3 (EC-SOD; IVS1+186C>T, Ex3-631C>G, Ex3-516C>T, and Ex3-489C>T), the three main isoforms of SOD. Prostate cancer cases (n = 1,320) from the screening arm of the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial were frequency matched to nondiseased controls (n = 1,842) by age, race, time since initial screening, and year of blood draw. Conditional logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (95% CI); stratified analysis by the level of antioxidative vitamins was also conducted. The higher activity Ala variant at SOD2 Ex2+24T>C (V16A), which has been hypothesized to suppress prostate carcinogenesis, was associated with elevation of prostate cancer risk in Caucasians (Val/Ala versus Val/Val: OR, 1.17; 95% CI, 0.97-1.42; Ala/Ala versus Val/Val: OR, 1.28; 95% CI, 1.03-1.60; P trend = 0.03). Stratification by quartiles of dietary and supplemental vitamin E intake (IU/d) showed risks of prostate cancer tended to be increased among SOD2 Ala allele carriers, except at the highest quartile of vitamin E intake (>222; P interaction = 0.06, Q1-Q3 versus Q4). The association between Ala allele and prostate cancer risk among those with lower intake of vitamin E (V222) was stronger for smokers (OR, 1.44; 95% CI, 1.10-1.90). No significant association with prostate cancer was observed for polymorphic variants in SOD3 or SOD1. These results suggest that the Ala variant of SOD2 is associated with moderately increased risk of prostate cancer, particularly among men with lower intakes of dietary and supplemental vitamin E. (Cancer Epidemiol Biomarkers Prev 2007;16(8):1581-6)

show abstract

Polymorphisms in the SOD2 and HLA-DRB1 Genes Are Associated with Nonfamilial Idiopathic Dilated Cardiomyopathy in Japanese

Cited by 163 publications

References 43 publications

Susceptibility of diabetics with superoxide dismutase gene 2 polymorphism to cardiovascular complications

Susceptibility of diabetics with superoxide dismutase gene 2 polymorphism to cardiovascular complications

Autoimmune cardiomyopathy and heart block develop spontaneously in HLA-DQ8 transgenic IAβ knockout NOD mice

Functional Variant of Manganese Superoxide Dismutase (SOD2 V16A) Polymorphism Is Associated with Prostate Cancer Risk in the Prostate, Lung, Colorectal, and Ovarian Cancer Study

Contact Info

Product

Resources

About