Polyunsaturated fatty acids synthesized by freshwater fish: A new insight to the roles of elovl2 and elovl5 in vivo

Sun, Shouxiang; Li, Xin; Cao, Xiaojuan; Gao, Jian

doi:10.1016/j.bbrc.2020.08.074

Cited by 35 publications

(19 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This capacity highlights the essential role of 20C PUFA in this group, serving as potential precursors of prostanoids. This potent ability has been observed in other freshwater fish, such as the zebrafish (Danio rerio) 74 .…”

Section: Effect Of Different Formulation Products On the Fatty Acid Profile Of The Dietssupporting

confidence: 52%

The utilization of new products formulated from water coconut, palm sap sugar, and fungus to increase nutritional feed quality, feed efficiency, growth, and carcass of gurami sago (Osphronemus goramy Lacepède, 1801) juvenile

et al. 2021

View full text Add to dashboard Cite

Background: Giant gourami (Osphronemus goramy Lacepede, 1801) has become popular aquaculture in Indonesia. However, information on the feed used is minimal. This study analyzed the change in feeding nutrition, fish growth, feed efficiency, and body-carcass using product formulated from water coconut, palm sap sugar, and fungus. Methods: A total of 2,000 ml coconut water and 1,000 ml of palm sap sugar solution were formulated. Each product formulated was added with 6 g of Aspergillus niger (called product P1), 6 g of Rhizopus oligosporus (called product P2), and 6 g of Saccharomyces cerevisiae (called product P3). Commercial feeds supplemented with P1, P2, and P3 products are designated P1, P2, and P3 diets. Commercial feed added to freshwater is called the P4 diet (placebo). Their dosage is 300 ml/kg of feed. Gurami sago juveniles (initial weight 50±2.5 g and length 13.2±0.4 cm) were stocked in triplicate nets (2×1×1 m) in a freshwater concrete pond with a stocking density of 30 fish/net, an initial feeding rate of 3% per day until study termination. Results: Our results support our hypothesis that different product formulations have a significant effect (p<0.05) on growth performance and feed efficiency. At the same time, supplementing commercial feed with varying formula products has a significant impact (p<0.05) on the fatty acid composition of the diets and carcass body of gurami sago. Conclusion: Diet P2 contains a higher concentration of fatty acids to increase body weight, feed efficiency, and the best carcass fatty acid composition than other experiments for sago gurami reared in freshwater concrete ponds.

show abstract

Section: Effect Of Different Formulation Products On the Fatty Acid Profile Of The Dietssupporting

confidence: 52%

The utilization of new products formulated from water coconut, palm sap sugar, and fungus to increase nutritional feed quality, feed efficiency, growth, and carcass of gurami sago (Osphronemus goramy Lacepède, 1801) juvenile

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Following all design principles, the Cas9 targeting site “GATTGTACCTGCATTGGGTCAGG” was determined. In vitro transcription of Cas9 RNA and gRNA was based on the standards of relevant research [ 53 ], and detailed construction methods were performed as previously described [ 54 ]. After microinjection, the genomic DNA was isolated from six randomly selected fertilized embryos.…”

Section: Methodsmentioning

confidence: 99%

Fibronectin 1B Gene Plays an Important Role in Loach Barbel Air-Breathing

Sun

Huang

et al. 2021

IJMS

Self Cite

View full text Add to dashboard Cite

Loach (Misgurnus anguillicaudatus) is well known to perform air-breathing through the posterior intestine and skin. However, we find here for the first time a unique central vascular structure in the loach barbel, with a blood–gas diffusion distance as short as that of the posterior intestine. Under acute hypoxia, the distance of loach barbels became significantly shorter. Moreover, barbel removal significantly decreased air-breathing frequency of the loach. These findings imply that the barbel is another air-breathing organ of the loach. For further investigation of loach barbel air-breathing, a transcriptome analysis of barbels with air exposure treatment was performed. A total of 2546 differentially expressed genes (DEGs) between the T-XU (air exposure) and C-XU (control) group were identified, and 13 key DEGs related to barbel air-breathing were screened out. On this foundation, sequence, expression, and location analysis results indicated an important positive role of fibronectin 1b (fn1b) in loach barbel air-breathing. We further generated an fn1b-depletion loach (MT for short) using the CRISPR/Cas9 technique. It was indicated that depletion of fn1b could weaker barbel air-breathing ability. In conclusion, due to nonlethal and regenerative characteristics, the loach barbel, a newly discovered and fn1b-related fish air-breathing organ, can be a good model for fish air-breathing research.

show abstract

“…Inc., Elysian, MN, USA) was used as an internal standard at 1.0 mg/mL hexane. FA composition of SFA, MUFA, and PUFA fractions were determined using gas chromatography (Agilent Technologies, Inc, Santa Clara, CA, USA; column: OmegawaxTM320) according to the method of Sun et al [18]. The temperature of the injector and detector were set at 250 • C and 260 • C, respectively.…”

Section: Fatty Acid Composition Analysismentioning

confidence: 99%

“…Elovl7 has been reported to be involved in the elongation of (C18-C22) SFAs, C18:1 and C18 PUFAs, 18:3n-3 [12,13]. The interest in deciphering the capacity of aquaculture fish species to biosynthesize the physiologically important long-chain polyunsaturated fatty acids (LC-PUFA) has led to widespread efforts to characterize Elovl2 and Elovl5 in a myriad of species [14][15][16][17][18][19][20]. The majority of the teleost Elovl5 possesses a preference toward C18 PUFA and C20 substrates, while Elovl2 is inclined to elongate C22 substrates [14,21].…”

Section: Introductionmentioning

confidence: 99%

“…Specific to LC-PUFA biosynthesis, the first bifunctional desaturase, a Fads2 with ∆5 and ∆6 activities, was reported from zebrafish [35]. Subsequently, the functional activities, dietary regulation, and expression profile of fads2 and various elovl paralogs in different tissue and developmental stages were studied using zebrafish [18,19,[36][37][38][39]. In addition, in vivo aspects of the transcriptional regulation fads2 and elovl5 were also investigated using zebrafish [40,41].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Evolution and Functional Characteristics of the Novel elovl8 That Play Pivotal Roles in Fatty Acid Biosynthesis

Sun

Wang

Goh

et al. 2021

Genes

Self Cite

View full text Add to dashboard Cite

Elongation of very long-chain fatty acid (Elovl) proteins are key enzymes that catalyze the rate-limiting step in the fatty acid elongation pathway. The most recently discovered member of the Elovl family, Elovl8, has been proposed to be a fish-specific elongase with two gene paralogs described in teleosts. However, the biological functions of Elovl8 are still to be elucidated. In this study, we showed that in contrast to previous findings, elovl8 is not unique to teleosts, but displays a rather unique and ample phylogenetic distribution. For functional determination, we generated elovl8a (elovl8a−/−) and elovl8b (elovl8b−/−) zebrafish using CRISPR/Cas9 technology. Fatty acid composition in vivo and zebrafish liver cell experiments suggest that the substrate preference of Elovl8 overlapped with other existing Elovl enzymes. Zebrafish Elovl8a could elongate the polyunsaturated fatty acids (PUFAs) C18:2n-6 and C18:3n-3 to C20:2n-6 and C20:3n-3, respectively. Along with PUFA, zebrafish Elovl8b also showed the capacity to elongate C18:0 and C20:1. Gene expression quantification suggests that Elovl8a and Elovl8b may play a potentially important role in fatty acid biosynthesis. Overall, our results provide novel insights into the function of Elovl8a and Elovl8b, representing additional fatty acid elongases not previously described in chordates.

show abstract

Polyunsaturated fatty acids synthesized by freshwater fish: A new insight to the roles of elovl2 and elovl5 in vivo

Cited by 35 publications

References 19 publications

The utilization of new products formulated from water coconut, palm sap sugar, and fungus to increase nutritional feed quality, feed efficiency, growth, and carcass of gurami sago (Osphronemus goramy Lacepède, 1801) juvenile

The utilization of new products formulated from water coconut, palm sap sugar, and fungus to increase nutritional feed quality, feed efficiency, growth, and carcass of gurami sago (Osphronemus goramy Lacepède, 1801) juvenile

Fibronectin 1B Gene Plays an Important Role in Loach Barbel Air-Breathing

Evolution and Functional Characteristics of the Novel elovl8 That Play Pivotal Roles in Fatty Acid Biosynthesis

Contact Info

Product

Resources

About