Possible Changes in Expression of Chemotaxin LECT2 mRNA in Mouse Liver after Concanavalin A-Induced Hepatic Injury.

Abstract

/nu؊ ) mice, the increase in TNF-a a and IFN-g g mRNA expression was found to be closely related to a reduction in LECT2 mRNA expression. These results suggest that the reduction in expression of LECT2 mRNA is not directly involved in apoptosis and may be inversely related to the expression of TNF-a a and/or IFN-g g mRNA in the injured liver.Key words leukocyte-derived chemotaxin 2; Con A-induced hepatic injury; apoptosis; LECT2; TNF-a and IFN-g mRNA bent assay (ELISA), as described previously.10) Briefly, excised liver was homogenized in a lysis buffer, allowed to stand at room temperature for 30 min, and then centrifuged at 700ϫg for 10 min. Twenty microliters of supernatant (equivalent to 170 mg wet weight liver tissue) was used for colorimetric measurement (450 nm) of DNA fragmentation using a cell death detection ELISA PLUS kit (Boehringer Mannheim, Mannheim, Germany).Western Blotting Analysis Sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) of mouse LECT2 protein in serum was performed as described by Laemmli using 14% gels.11) Proteins were blotted onto a PVDF filter (Millipore Japan, Tokyo, Japan). Purified polyclonal antibodies diluted to 0.2 mg/ml with phosphatebuffered saline (PBS) containing 3% skimmed milk were laid onto the filter. The filter was incubated for 60 min at room temperature and then washed three times with washing buffer containing 0.1% Tween 20 in PBS. Horseradish peroxidaseprotein G was then placed on the filter and allowed to stand for 60 min at room temperature. The filter was washed three times with washing buffer and positive bands were detected with an ECL detection kit (Amersham Pharmacia, Biotech AB, Uppsala, Sweden).RNA Isolation and Probe Labeling Total RNA was prepared from mouse liver using Isogen (NipponGene, Toyama, Japan), and 1 mg of RNA was reverse transcribed using avian myeloblastosis virus reverse transcriptase (Takara Shuzo, Kyoto, Japan) in a reaction volume of 20 ml containing oligodT-adaptor primers.12) Polymerase chain reaction (PCR) amplification was performed with GeneAmp 9700 (Perkin-Elmer Foster, CA, U.S.A.), in a reaction volume of 50 ml containing 1 ml of DNA solution. The mouse LECT2 and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers were as follows: LECT2: TCCTCGAGATGATTCC-CACAACAATC and TGCTCGAGTAGGTATGCTGTGG; G3PDH: TGAAGGTCGGTGAACGGATTTGGC and CAT-GTAGGCCATGAGGTCCACCAC. LECT2 and G3PDH cDNA probes were prepared by second PCR amplification using digoxigenin-11-dUTP (Roche Diagnostics, Mannheim, Germany).Northern Blotting Analysis RNA samples (20 mg/lane) were subjected to electrophoresis in a 1% agarose gel containing 2.2 M formaldehyde, and then transferred to nylon membranes. The membranes were prehybridized and hybridized with digoxigenin-11-dUTP-labeled cDNA probes.TNF-a a, IFN-g g and LECT2 mRNA Expression in Liver Total liver RNA was amplified by reverse transcriptase-PCR (RT-PCR), electrophoresed on a 2.0% agarose gel and TNFa, IFN-g and LECT2 mRNA expression was then examined. In the RT-PCR, TCCTCGAGATGATTCCCACAAC...

Crystal Structure of Human Leukocyte Cell-derived Chemotaxin 2 (LECT2) Reveals a Mechanistic Basis of Functional Evolution in a Mammalian Protein with an M23 Metalloendopeptidase Fold

“…LECT2 is predominantly expressed in the liver and is a direct target gene of Wnt/␤-catenin signaling (2)(3)(4)(5)(6). Accumulating evidence shows that mammalian LECT2 is a multifunctional protein that is closely associated with several diseases of worldwide concern, including hepatitis (7), rheumatoid arthritis (8 -10), hepatocellular carcinoma (HCC) (11,12), obesity (13,14), and renal and hepatic amyloidosis (15)(16)(17).…”

Leukocyte cell-derived chemotaxin 2 (LECT2)–associated amyloidosis is a frequent cause of hepatic amyloidosis in the United States

“…[20][21][22] A cytokine is involved in the regulation of hepatocyte activity and functions as an immunomodulator. 23 A polymorphism (Val58Ile) in the LECT2 gene (LECT2) was demonstrated to be a risk factor for the progression of rheumatoid arthritis. 24 We investigated the expression of LECT2 protein and mRNA in hepatic amyloidosis and in normal and neoplastic tissues (supplemental Table 2).…”

The tumor suppressor function of LECT2 in human hepatocellular carcinoma makes it a potential therapeutic target

“…[11][12][13][14][15][16][17] It was originally identified as a novel neutrophil-chemotactic protein by Yamagoe et al in 1996. 17 LECT2 is a 16-kDa protein that consists of 133 amino acids and three intra-molecular disulfide bonds. 18,19 The human LECT2 gene consists of four exons and three introns.…”

“…Kameoka et al 11 reported a polymorphism of the human LECT2 gene in the Japanese population associated with a severe form of rheumatoid arthritis that leads to progressive joint destruction. Using the concanavalin A-induced hepatic injury model, Segawa et al 15 reported that LECT2 expression in the mouse liver was inversely regulated by TNF-a and/or IFN-g. Saito et al…”