Prevalence and Density-Related Concordance of Three Diagnostic Tests for Malaria in a Region of Tanzania with Hypoendemic Malaria

Abstract

Accurate malaria diagnosis has dual roles in identification of symptomatic persons for effective malaria treatment and also enumeration of asymptomatic persons who contribute to the epidemiologic determinants of transmission. Three currently used diagnostic tests, microscopy, rapid diagnostic tests (RDTs), and real-time PCR, all have different sensitivities and specificities, which are parasite density dependent. Here, we compare their concordance among 451 febrile episodes in a cohort of 2,058 children and adults followed over 6 months in a region in central Tanzania with hypoendemic malaria. Microscopy, a histidine-rich protein-based RDT, and two different real-time PCR gene probes detected Plasmodium falciparum in 20, 54, 41, and 78 episodes of fever, respectively. They had complete concordance in only 9 episodes. Real-time PCR with an 18S probe was more sensitive than with a mitochondrial probe for cytochrome b despite higher copy numbers of mitochondrial DNA. Both PCR yields were increased 4-fold by glycogen/acetate precipitation with low-speed centrifugation. Duplicate PCR increases low-density malaria detection. RDT had the highest number of unique positives, presumably from persistent antigen despite the absence of parasites, although RDT did not detect 3 parasitemias with over 1,000 parasites/l. In a latent class analysis, real-time PCR had significantly higher sensitivity than did microscopy or RDT. Agreement between real-time PCR, RDT, and microscopy was highest in March and April, when both the P. falciparum parasite rate and parasite densities are highest. Real-time PCR is more sensitive and specific than RDT and microscopy in low-prevalence, low-parasite-density settings.Low-prevalence, or hypoendemic, malaria poses particular diagnostic challenges because low population prevalence reduces the positive predictive value of tests. Moreover, test sensitivity suffers when parasite densities within individual infections are low (3). The proportion of low-density infections may rise with decreasing transmission (2), so hypoendemicity diminishes test sensitivity, as well as the positive predictive value (3). Malaria diagnostics, such as real-time PCR (RT-PCR), chromatographic rapid diagnostic tests (RDTs), and traditional Giemsa staining and microscopy, have performed differently across ecoepidemiological settings, leading to varying estimates of agreement between tests. Agreement between microscopy and PCR has been shown to be poor under hypoendemicity (malaria prevalence of less than 10%) (5), and agreement between RDT and RT-PCR or microscopy may also decline when the prevalence is low.We compared the yields of RT-PCR, RDT, and microscopy for the diagnosis of Plasmodium falciparum malaria in a cohort of 2,058 adults and children from a district in central Tanzania with hypoendemic malaria followed from January to June 2009. The district has seasonal malaria, coinciding with the rainy season, and in the study year, malaria was hypoendemic. The cohort was assembled to investigate the ancillary benefits o...

Short-Term Malaria Reduction by Single-Dose Azithromycin during Mass Drug Administration for Trachoma, Tanzania

“…Study participants were from 8 rural agricultural villages in Dodoma Province, central Tanzania ( 18 – 20 ). The study period was January 12, 2009–July 21, 2009 and was coincidental with a period in which rainfall was <60% of the average amount ( 21 , 22 ).…”

Multiplex 5′ Nuclease Quantitative Real-Time PCR for Clinical Diagnosis of Malaria and Species-Level Identification and Epidemiologic Evaluation of Malaria-Causing Parasites, Including Plasmodium knowlesi

“…We initially selected amplification targets for P. falciparum, P. vivax, P. malariae, and P. ovale based on prior publications (7) and available gene sequences in GenBank. We verified specific 18S rRNA gene primers and probes only for P. falciparum (8); hence, we targeted the apical membrane antigen 1 (AMA1) gene in P. vivax and the plasmepsin genes in P. ovale (GenBank accession no. AF001209), P. malariae (GenBank accession no.…”

“…The primers (forward and reverse) and probes targeting 18S rRNA (P. falciparum) (8), AMA1 (P. vivax), and plasmepsin (P. ovale, P. malariae, and P. knowlesi) are shown in Table 1. The forward and reverse primers for ACTB were GTGCTCAGGGCTTCTTGTCC and CCATGTC GTCCCAGTTGGT, respectively, and the probe was Texas Red-or hexachloro-6-carboxyfluorescein (HEX)-ACCCATGCCCACCATCACGCC C-black hole quencher 1 (BHQ1).…”

“…Samples for which qPCR results did not agree with smear results were considered discordant. Discordant samples were retested with at least one additional PCR method, i.e., our multiplex qPCR assay, an alternative target PCR assay used by the Mayo Clinic Reference Laboratory (9), and 2 singleplex assays for P. falciparum (targeting the 18S [1/4 targets in our multiplex assay] and cytochrome B [CYTB] [8] genes), and melting curve analysis (the CYTB target for P. falciparum melts at 76°C and P. vivax AMA1 at 82.5°C). As a secondary analysis, we considered samples with identical results with two different DNA targets as true-positive PCR results, since assigning a species is not always possible with microscopy.…”

“…We have prospectively evaluated the described 18S rRNA gene P. falciparum target in a clinical trial of chemoprophylaxis for the prevention of infection with P. falciparum (26) and found it equivalent to microscopy (minimum of 200 oil-immersion fields per thick blood film reviewed). Our 18S rRNA gene P. falciparum target also was assessed in a Ͼ2,000-person cohort followed for 6 months in a hypoendemic area of Tanzania (8). Using latent-class analysis, we found it to be more sensitive than microscopy, RDTs, and a CYTB target for the detection of symptomatic and asymptomatic P. falciparum malaria, despite extraction of blood DNA from small volumes (ϳ25 l of blood on filter paper) rather than the large volumes (ϳ1 ml) reported here.…”