Rab11 mediates selective recycling and endocytic trafficking in Trypanosoma brucei

Abstract

Trypanosoma brucei possesses a streamlined secretory system that guarantees efficient delivery to the cell surface of the critical glycosyl-phosphatidylinositol (GPI)-anchored virulence factors, variant surface glycoprotein (VSG) and transferrin receptor (TfR). Both are thought to be constitutively endocytosed and returned to the flagellar pocket via TbRab11+ recycling endosomes. We use conditional knockdown with established reporters to investigate the role of TbRab11 in specific endomembrane trafficking pathways in bloodstream trypanosomes. TbRab11 is essential. Ablation has a modest negative effect on general endocytosis, but does not affect turnover, steady state levels or surface localization of TfR. Nor are biosynthetic delivery to the cell surface and recycling of VSG affected. TbRab11 depletion also causes increased shedding of VSG into the media by formation of nanotubes and extracellular vesicles. In contrast to GPI-anchored cargo, TbRab11 depletion reduces recycling of the transmembrane invariant surface protein, ISG65, leading to increased lysosomal turnover. Thus, TbRab11 plays a critical role in recycling of transmembrane, but not GPI-anchored surface proteins. We proposed a two-step model for VSG turnover involving release of VSG-containing vesicles followed by GPI hydrolysis. Collectively, our results indicate a critical role of TbRab11 in the homeostatic maintenance of the secretory/endocytic system of bloodstream T. brucei.

Late ESCRT Machinery Mediates The Recycling And Rescue of Invariant Surface Glycoprotein 65 inTrypanosoma brucei

“…Thus it is likely that VSG en route to the cell surface is subject to proteolysis by TbCatL that has been misdirected into the secretory pathway by TbVps24 ablation (see Figs 3A & 3B). Previously our lab has shown that depletion of the essential housekeeping enzyme ornithine decarboxylase (similar kinetics of silencing and lethality) had no effect on VSG shedding (Umaer, Bush, & Bangs, 2018), confirming that the increase in shedding observed here is related to the knockdown of TbVps24, and not due to a non-specific effect on cell viability.…”

“…(Hall et al, 2005). Validated markers for each compartment are: EE, TbRab5A/B (Pal, Hall, Nesbeth, Field, & Field, 2002); RE, TbRab11 Umaer et al, 2018); LE, TbRab7 Silverman et al, 2011), TbRab28 (Lumb et al, 2011), TbVps4 (Silverman et al, 2013), TbVps23 Silverman et al, 2013), and TbVps24 (this work); Lyso, p67 (Alexander et al, 2002) and TbCatL (Koeller & Bangs, 2018;Peck et al, 2008). TbFab1 localizes to both LE and Lyso (Gilden et al, 2017).…”

“…Biosynthetic trafficking of this protein is dependent on both clathrin and canonical di-leucine motifs in its cytoplasmic domain, but when the cytoplasmic domain is deleted it still arrives in the lysosome with similar kinetics via an alternate 'default' route (Alexander et al, 2002;Tazeh et al, 2009). That these routes differ is confirmed by the fact that knock down of both TbVps4 and TbRab11 dramatically reduces lysosomal trafficking of native p67, but has no effect on the truncated mutant (Silverman et al, 2013;Umaer et al, 2018). Thus it is not difficult to envision that 'doomed' ISG65 that normally goes to the lysosome in an ESCRT-dependent manner will still find a way when this route is blocked.…”

“…Second, knockdown of TbRab11 blocks the recycling endosome (RE)-to-flagellar pocket pathway (Fig. 8, #2), leading to enhanced ISG65 turnover with concomitant reduction in the surface pool (Umaer et al, 2018).…”

“…Quantitative real-time PCR The levels of mRNA knockdown of TbVps24 RNAi cells were quantified using primers specific for TbVps24 (FP 5' GATGAAGTTGAGAAGGTTGTGG 3' and RP 5' AACCTTGCCACTAACTCGTC 3'). RNA isolation, DNase treatment, cDNA synthesis and quantitative PCR were performed as described previously (Umaer et al, 2018). TbZFP was used as a reference gene.…”