Rapid and specific detection of Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans by PCR

Escobar, Beatriz; Bustos, Karina; Morales, Gladys; Salazar, Osvaldo

doi:10.1016/j.hydromet.2008.01.012

Cited by 22 publications

(11 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To quantify the abundance of Acidithiobacillus ferrooxidans at all sites, qPCR was performed with species‐specific primers F1_Thio (ATGCGTAGGAATCTGTCTTT) and R1_Thio (GGACTTAACCCAACATCTCA) and universal bacterial primers 1108F (ATGGYTGTCGTCAGCTCGTG) and 1132R (GGGTTGCGCTCGTTGC) as described previously (Escobar et al ., 2008; Větrovský et al ., 2010). Amplifications were performed on a StepOne Plus cycler (Applied Biosystems) using optical grade 96‐well plates.…”

Section: Methodsmentioning

confidence: 99%

Development of bacterial community during spontaneous succession on spoil heaps after brown coal mining

Urbanová

Kopecký

Valášková

et al. 2011

FEMS Microbiology Ecology

View full text Add to dashboard Cite

Changes in the abundance of bacteria and fungi and in the composition of bacterial communities during primary succession were investigated in a brown coal mine deposit area near Sokolov, the Czech Republic, using phospholipid fatty acids analysis, microarray and 16S rRNA gene sequencing. The study considered a chronosequence of sites undergoing spontaneous succession: 6-, 12-, 21- and 45-year-old and a 21-year-old site revegetated with Alnus glutinosa. During succession, organic carbon and the total nitrogen content increased while the pH and the C/N ratio decreased. Microbial biomass and bacterial diversity increased until 21 years and decreased later; bacteria dominated over fungi in the initial and late phases of succession. Bacterial community composition of the 6-year-old site with no vegetation cover largely differed from the older sites, especially by a higher content of Gammaproteobacteria, Cyanobacteria and some Alphaproteobacteria. Bacteria belonging to the genera Acidithiobacillus, Thiobacillus and related taxa, the CO(2) and N(2) fixers, dominated the community at this site. In the later phases, bacterial community development seemed to reflect more the changes in soil nutrient content and pH than vegetation with a decrease of Actinobacteria and an increase of Acidobacteria. The site revegetated with A. glutinosa resembled the 45-year-old primary succession site and exhibited an even lower pH and C/N ratio, indicating that recultivation is able to accelerate soil development.

show abstract

Section: Methodsmentioning

confidence: 99%

Development of bacterial community during spontaneous succession on spoil heaps after brown coal mining

Urbanová

Kopecký

Valášková

et al. 2011

FEMS Microbiology Ecology

View full text Add to dashboard Cite

show abstract

“…A. ferrooxidans was isolated by streak plating from AMD in the Jiguan Mountain Cu‐Au sulfide mine in Anhui Province, eastern China. The strain was identified by 16S rDNA using existing methods . After amplification of 16S rDNA by PCR, the sequence of this strain was determined by Invitrogen, Inc. (Shanghai, China) and was compared with the known sequence A. ferrooxidans ATCC23270 using the Basic Local Alignment Search Tool.…”

Section: Methodsmentioning

confidence: 99%

Compensation phenomena found in Acidithiobacillus ferrooxidans after starvation stress

Guo

et al. 2013

J. Basic Microbiol.

View full text Add to dashboard Cite

Acidithiobacillus ferrooxidans showed the compensate growth and oxidation after re-feeding with sufficient ferrous materials after starvation. Compensatory phenomena were first detected in chemoautotrophic organisms. Starvation stress of Acidithiobacillus ferrooxidans was achieved via culturing in low concentrations of iron. During compensation, growth and ferrous oxidation took place faster than in controls. In addition, some genes related to ferrous oxidation (such as rus) and carbon assimilation (cbbR, csoS3) were expressed in different patterns in the low energy environments. Their expression patterns can account for this increased growth and oxidation. Other groups of genes (cspAB, feoAB, fur) were suppressed in response to starvation stress. The presence of pyrite and joint cold stress can render compensation nearly undetectable. This may be why the compensation phenomena observed under these conditions was not the same as that observed under single starvation stress conditions. Gene expression reflected a possible mechanism of tolerance to starvation in Acidithiobacillus ferrooxidans, which would allow the organism to adapt and survive in ferrous-limited environments.

show abstract

“…Conventional plate count methods and biochemical identification methods described previously could not circumvent the problems linked to the long wait for the colony to develop and/or the inability of some bacteria to grow on solid media (Johnson, 1991;Ahmad, 1993). In recent years, various nucleic acid-based molecular methods, such as Polymerase chain reaction (PCR) method (Feng et al, 2012;Escobar et al, 2008;Kamimura et al, 2001;DeWulfDurand et al, 1997) and fluorescent in situ hybridization (FISH) (Mahmoud et al, 2005), have been developed for the rapid detection and identification of Acidithiobacillus strains because of simplicity in operation, stable detection results, and savings in time. A high level of marker specificity is crucial for various nucleic acid-based molecular methods.…”

Section: Atc_1903mentioning

confidence: 99%

Insights into the characterization of ars genes in the biomining bacterium Acidithiobacillus caldus SM-1

Yu¹,

Yangwu²,

Zhao³

et al. 2013

Afr. J. Microbiol. Res.

View full text Add to dashboard Cite

Acidithiobacillus caldus is an extremely acidophilic, moderately thermophilic, chemoautotrophic bacterium, which has been used to treat gold-bearing arsenopyrite ores. The arsenic resistance system (ars operon) was responsible for arsenic resistance of A. caldus. To investigate the characterization of ars genes, we analyzed 12 ars genes in A. caldus SM-1 using the bioinformatics database and softwares. Their amino acid composition and physical and chemical characteristics were predicted. Secondary structure simulations revealed that the dominant patterns were predicted to be alpha helix and random coil among the 12 ars proteins. Three-dimensional structure analysis showed that there totally existed three major types of three-dimensional structure of the 12 ars proteins in A. caldus SM-1. Subcellular localization of these proteins indicated that these ars proteins were mainly located in the bacterial cytoplasm, while Atc_0977, Atc_1809 and Atc_m110 were especially localized in bacterial inner membrane. Furthermore, DNA-binding residues in ArsR proteins and binding sites of ArsC-As were predicted. Phylogeny analysis revealed that A. caldus, A. ferrooxidans, A. ferrivorans and A. thiooxidans were well-supported group based on ArsB and ArsC sequences data. This bioinformatics analysis of ars genes could help in probing to the arsenic resistance of A. caldus SM-1.

show abstract

Rapid and specific detection of Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans by PCR

Cited by 22 publications

References 21 publications

Development of bacterial community during spontaneous succession on spoil heaps after brown coal mining

Development of bacterial community during spontaneous succession on spoil heaps after brown coal mining

Compensation phenomena found in Acidithiobacillus ferrooxidans after starvation stress

Insights into the characterization of ars genes in the biomining bacterium Acidithiobacillus caldus SM-1

Contact Info

Product

Resources

About