Regulatory elements in the 5’region of 16SrRNA gene of Bacillus sp. strain SJ-101

Abstract

Advancement in bioinformatics with the development of computational tools has enabled the in­silico prediction and identification of transcription regulatory factors and other genetic elements with great ease. In this study, computational analysis of sequence homology of 546 bp 5’ region of 16SrRNA gene of Bacillus sp. strain SJ­101 resulted in identification of promoter­like sequences within the rrn gene. Using BPROM tool, the regulatory motifs like -35 and -10 boxes were mapped at 392 and 411 positions, respectively. Furthermore, the cis-acting elements as the binding sites for transcription factors (TF) cpxR and argR were identified at positions 413 and 416 at the upstream of an open reading frame (ORF). The probable functions of the putative TFs were predicted through the Uni­Prot/Swiss­Prot protein database. Search for the Shine­Dalgarno sequence (SD) found the presence of highly conserved SD sequence (AATACC), and a short 42 bp coding sequence/ORF bounded with characteristic transcription start site (AAC) and a stop codon (TGA) at positions 426 and 465 downstream to the promoter elements. A 13 amino acid long translation product of a short ORF has exhibited 100% homology with protein sequences of Bacillus spp., while showing some degree of polymorphism with other reference strains. The comparative homology of the small protein exhibited maximum similarity with Prolyl­4 hydroxylase of Chlamydomonas reinhardtii with 4.11 ZSCORE. The highly conserved regulatory elements and the putative ORF predicted within the 16SrRNA gene may help understand the role of relatively unexplored short ORFs within rrn operon, and their functional products in genetic regulatory mechanisms in eubacteria.

Development and Application of Two Inducible Expression Systems for Streptococcus suis

“…To construct an ATc-inducible expression system, the repressor gene tetR was driven by promoter P g , and the operator sequence was inserted into promoters P t and P e . The putative −10 and −35 regions and the transcription start site of the promoters were analyzed by using Softberry BPROM software ( 28 ) ( Fig. 2A ).…”

Isolation, identification and computational studies on Pseudomonas aeruginosa sp. strain MPC1 in tannery effluent

“…[ 10 , 11 , 13 , 16 ]. The evolutionary history was inferred using the Neighbor-Joining method [ 1 , 2 , 8 , 13 ]. The optimal tree with the sum of branch length = 112.96911444 is shown in Figure 1 .…”

“…Computational studies have evolved to include the creation and exploration of sequence alignments, the estimation of sequence divergence, the reconstruction and visualization of phylogenetic trees, and the testing of molecular evolutionary hypotheses. To understand more information about 16s rRNA sequence, the study is extended to identification of promoter position ( Figure 2 ) and secondary structure prediction ( Figure 3 ) [ 2 , 14 , 15 , 20 ].…”

Isolation and characterization of a bisphenol A-degrading strain, Pseudomonas aeruginosa DU2, from soil containing decaying plants

“…Genomic DNA was extracted by using Pouya Gene Azma kit (Iran) according to the manufacturer’s instructions. The PCR reaction in a final volume of 25 μL contained: 0.5 μL (250 ng DNA) of the DNA template, 1 μL (10 pmol) from fD1 (AGAGTTTGATCCTGGCTCAG) and rD1 (AAGGAGGTGATCCAGCC) primers ( 24 ), 1 μL dNTP Mix (10 mM; SinaClon, Iran), 0.8 μL Taq DNA polymerase (10 U/μL) (Sina-Clon, Iran), 2.5 μL 10 × Buffer, and 0.75 μL MgCl 2 (50 mM). The thermal cycling program was as follows: initial denaturation of 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 51°C for 30 s and 72°C for 1 min, with a final elongation of 72°C for 10 min.…”