Reprogramming of Somatic Cells After Fusion With Induced Pluripotent Stem Cells and Nuclear Transfer Embryonic Stem Cells

Abstract

In this study we examine whether a somatic cell, once returned to a pluripotent state, gains the ability to reprogram other somatic cells. We reprogrammed mouse embryonic fibroblasts by viral induction of oct4, sox2, c-myc, and klf-4 genes. Upon fusion of the resulting iPS cells with somatic cells harboring an Oct4-GFP transgene we observed, GFP expression along with activation of Oct4 from the somatic genome, expression of key pluripotency genes, and positive immunostaining for Oct4, SSEA-1, and alkaline phosphatase. The iPS-somatic hybrids had the ability to differentiate into cell types indicative of the three germ layers and were able to localize to the inner cell mass of aggregated embryos. Furthermore, ntES cells were used as fusion partners to generate hybrids, which were also confirmed to be reprogrammed to a pluripotent state. These results demonstrate that once a somatic cell nucleus is reprogrammed, it acquires the capacity and potency to reprogram other somatic cells by cell fusion and shares this functional property with normal embryonic stem (ES) cells.

Comparison of reprogramming ability of mouse ES and iPS cells measured by somatic cell fusion

“…It has previously been shown that both mouse iPS (Maherali et al, 2007;Sumer et al, 2010a) and SCNT derived ntES cells somatic cell hybrids is high and similar to those of ES cells (Cowan et al, 2005;Sumer et al, 2010b), and may be the underlying mechanism for the lengthening of the somatic cell derived chromosomes telomeres in hybrids (Sumer et al, 2010b). Telomere repeat amplification protocol (TRAP) assay was conducted on cell lysates from equal number of cells in order to determine the levels of telomerase activity of the various cell lines (Fig.…”

“…R, GGTTGTTGCCCTCATCTCTCT (Sumer et al, 2010a), like ES cells, have the ability to reprogram a somatic genome following cell fusion. In the present study we have shown that iPS cells are as efficient as ES cells at reprogramming somatic cells by cell fusion.…”

“…It has been previously reported that both iPS (Maherali et al, 2007;Sumer et al, 2010a) and ntES cells (Sumer et al, 2010a) can reprogram somatic cells by cell fusion. These results suggest that once a somatic cell nucleus is reprogrammed, it itself has the capacity and potency to reprogram other somatic cells by cell fusion -a functional property shared with ES cells.…”

iPS Cells: Born-Again Stem Cells for Biomedical Applications

“…This is echoed by recent experiments: somatic cells, when fused with pluripotent cells (either ESCs or iPSCs) always produce binucleate cells with both nuclei in a pluripotent state (Sumer et al, 2009). Furthermore, induced pluripotency has been demonstrated at extremely low (0.006%) efficiencies through the use of recombinant pluripotent factors with multiple treatments over an 8-week period.…”

Hybrid cells differentiate to hepatic lineage cells and repair oxidative damage

“…Fusing somatic cells with stem cells allows the resulting hybrid cells to be reprogrammed as stem cell-like cells. Recently, hybrid cells derived from stem cells have been proven to be reprogrammable into ES cell-like cells in vitro [14][15][16][17][18][19][20]. They are pluripotent and are capable of contributing to cells from all three germ lines.…”