Restriction fragment length polymorphisms, races and vegetative compatibility groups within a worldwide collection of Fusarium oxysporum f.sp. gladioli

Abstract

Isolates of Fusarium oxysporum f.sp. gladioli were collected from widely different geographic areas. These isolates were characterized by pathogenicity to two differential gladiolus cultivars, vegetative compatibility, and total genomic DNA restriction fragment length polymorphisms (RFLPs). RFLPs were used to estimate the genetic divergence and relationship among isolates of F. oxysporum. RFLPs were detected by Southern blot hybridization of total genomic DNA with a 3-4 kb DNA probe generated from total DNA of F. oxysporum f.sp. dianthi. Cluster analysis allowed the division of pathogenic strains into three main RFLP groups, each group containing strains with similarity coefficients ranging from 78 to 100%. RFLP groups correlated with vegetative compatibility groups, not with races. Two single pathogenic isolates which could not be assigned to any of the three main vegetative compatibility groups also had distinctive RFLP patterns. Little genetic polymorphism was observed within vegetative compatibility groups, whereas the majority of RFLPs occurred between vegetative compatibility groups, suggesting a common ancestry for strains within a spwcific vegetative compatibility group and a polyphyletic origin for the present special form gladioli. o».. 3... 99 76 no 90 75 101 90 96 99Corm disease PP 0,4,0,0,0 1,2,3,2,3 0,0,0,0,3 0,0,0,0,0 0,0,0,0,2 0,0,0,0.0 0,0,0,0,0 0,0,0,0,0 0,0,0,0,0 0,0,0,0,0 0,0,0,0,0 rot index N Race 0,0,0,1,1

Foxy: an active family of short interspersed nuclear elements from Fusarium oxysporum

“…Fungal DNA was isolated by the cetyltrimethylammonium bromide (CTAB) method as described previously (Mes et al 1994). RAPD (random ampli®ed polymorphic DNA) analysis was carried out according to Williams et al (1990;see Mes et al 1999a).…”

“…dianthi (F1068) Baayen et al (1997) F. oxysporium f. sp. gladioli (G2) Mes et al (1994) F. redolens Waalwijk et al (1996) F. anthophilum Waalwijk et al (1996 F. sacchari var. sacchari Waalwijk et al (1996) F. subglutinans Waalwijk et al (1996) F. verticilloides Waalwijk et al (1996 F. fujikuroi Waalwijk et al (1996) F. nygamai Waalwijk et al (1996) F. proliferatum Waalwijk et al (1996) F. culmorum Waalwijk et al (1996) F. graminearum Waalwijk et al (1996 F. poae Waalwijk et al (1996) together with the occurrence of many Foxy-speci®c polymorphisms between isolates within one VCG, indicate that Foxy is currently active.…”

“…The fungus appears in many specialized forms, grouped into formae speciales and races, depending on the ability to infect speci®c plant species and cultivars thereof, respectively (Armstrong and Armstrong 1981). Within a given forma specialis one or more vegetative compatibility groups (VCGs) can be found, representing clonal lines (Mes et al 1994). Since races may originate from dierent VCGs within a given forma specialis, the degree of genetic diversity within races may vary considerably.…”

Molecular characterisation of vegetative compatibility groups in Fusarium oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici by random amplification of polymorphic DNA and microsatellite-primed PCR

“…(Katan et al, 1991;Katan and Katan, 1999;Rosewich et al, 1999;Di Primo et al, 2001;Kalman et al, 2001) and F.o.l. (Elias and Schneider, 1992;Elias et al, 1993;Mes et al, 1994;Cai et al, 2003;Gale et al, 2003). F.o.r.l.…”

Genetic diversity of Fusarium oxysporum f. sp. spinaciae in Japan based on phylogenetic analyses of rDNA-IGS and MAT1 sequences

“…Moreover, it was revealed that each phylogenetic group in each forma specialis consisted of isolates of one or two VCGs, and the VCGs are distinctive between the groups (Bentley et al 1998;Fernandez et al 1994; Appel and Gordon (1996) Appel and Gordon (1996) FIGS12 GCAAAATTCAATAGTATGGC nt. 1056-1037 bp at F. oxysporum intergenic spacer region, refered to sequences in Appel and Gordon (1996) Appel and Gordon ( Fujinaga et al 2005;Kawabe et al 2005;Kistler 1997;Koenig et al 1997;Manicom and Baayen 1993;Vakalounakis and Fragkiadakis 1999;Mes et al 1994;Woudt et al 1995). In contrast, phylogenetic groups in FOS were composed of VCG0330 and/or 0331 and VCGs did not reflect genetic relationships (Fig.…”