Restructuring citrus endophytic diversity through potential indigenous endophytes could eliminate huanglongbing pathogen Candidatus Liberibacter asiaticus

Abstract

Background Huanglongbing (HLB) is a major botanical pandemic of citrus crops caused by Candidatus Liberibacter asiaticus (Clas). It is important to understand the different mechanisms involved in interaction of pathogen with plants to develop novel management strategy against HLB. However, until now there has been no control strategy to manage this disease in vitro and on large scale in citrus grove. We found that, indigenous endophyte Bacillus subtilis L1-21, a patented strain isolated from healthy citrus tree, may have the potential to reduce the impact of pathogen through restructuring of core endophytes. Results A novel half-leaf method was developed to test the efficacy of B. subtilis L1-21 against Clas. Concentration of B. subtilis L1-21 at 104 cfu ml− 1 resulted in a 1000-fold reduction in Clas copy densities per gram of leaf midrib (107 to 104) by 4 d after treatment. With endophytes, where HLB incidence was reduced to < 3% and Clas copy density was reduced from 109 to 104 pathogen g− 1 of diseased leaf midrib. We found that 16 of 93 tree samples became Clas-free and functional pathways and pathogen resistance genes were regulated in diseased citrus trees after treatment. Conclusions This is the first large-scale study using an indigenous endophyte and shows its potential utility in sustainable disease management through strengthening the citrus microbiome.

Interactions between Indigenous Endophyte Bacillus subtilis L1-21 and Nutrients inside Citrus in Reducing Huanglongbing Pathogen Candidatus Liberibacter Asiaticus

“…Diseased leaves were selected from HLB-affected citrus plants grown under greenhouse of Yunnan Agricultural University, China and confirmed through qPCR using primer sequence CQULA04F 5 TGGAGGTGTAAAAGTTGCCAAA 3 , CQULA04R 5 CCAAC-GAAAAGATCAGATATTCCTCTA 3 . Half leaf methods were applied as designed by Munir et al [24], with some modifications. Leaves were further treated with different candidate endophytes.…”

“…Their effective use will reduce the dependence on chemical fertilizers and pesticides [23]. Keeping the importance of previous studies in citrus plants using endophyte L1-21, remarkable changes were observed in healthy and diseased citrus plants [24]. Metabolomics approaches were conducted to gain information about the molecular mechanism of citrus plant to defend themselves against CLas [25].…”