Robust CD4⁺ and CD8⁺ T cell responses to SIV using mRNA‐transfected DC expressing autologous viral Ag

Abstract

A potentially powerful strategy for therapeutic HIV vaccination is the use of DC transfected with mRNA encoding autologous viral Ag, as epitopes presented by transfected DC would exactly reflect those expressed by infected cells in the individual. Using human and rhesus macaque monocyte-derived DC, we show that nucleofection is a superior method for mRNA transfection, resulting in high-level protein expression and DC maturation. DC transfected with SIV gag isolated from an infected monkey stimulated robust Ag-specific recall T cell responses of similar magnitude to those induced by peptide-pulsed PBMC that were predominantly CD8 + T cell mediated. Enhanced CD4 + T cell responses were stimulated when Gag was redirected into the lysosomal pathway via the targeting signal derived from lysosome-associated membrane protein-1 (LAMP-1). Rhesus DC transfected with lysosome-targeted gag encoding an escape mutation in an immunodominant CTL epitope stimulated CD4 + and CD8 + T cell responses of almost equivalent magnitude directed towards undefined epitopes outside of the mutated region. Finally, gag-transfected DC from SIV-infected monkeys stimulated significant Ag-specific recall T cell responses in an entirely autologous system. These findings demonstrate that mRNA-transfected DC expressing SIV Ag derived from infected monkeys stimulate broad and relevant T cell responses, supporting this approach for therapeutic HIV vaccine development. IntroductionIt is well appreciated that strong CD4 + and CD8 + T cell immunity is required for control of HIV infection [1][2][3][4][5], and therapeutic vaccines designed to promote broad cellular immune responses are being actively pursued [6]. However, an important challenge in the development of vaccines for HIV is the diversity of clinical isolates [7] coupled with the propensity for the virus to undergo escape mutations in T cell epitopes through selective pressure in vivo [8]. Hence, CTL induced in response to the infecting strain may be incapable of controlling circulating virus as infection progresses [9][10][11][12]. To account for this complexity, a therapeutic vaccine should be tailored towards the autologous virus present in an individual at the time of immunotherapy. An attractive alternative source of viral Ag for therapeutic DC-based vaccination is mRNA, an approach that has been developed in the cancer immunotherapy field [23,24]. DC transfected with codon-optimized HIV mRNA have been shown to induce strong T cell immune responses in vitro [25,26] with enhanced CD4 + T cell responses arising from DC expressing lysosome-targeted Ag [27]. DC transfected with autologous viral mRNA isolated from HIV-infected individuals induce significant virus-specific T cell responses [25]. The rhesus macaque SIV model provides an ideal preclinical setting to test the therapeutic potential of DC-based vaccines using virusderived mRNA. Here, we evaluated the capacity of mRNA-transfected DC to stimulate T cell responses against SIV using an in vitro system. We adopted a new electroporation ...

Efficient In Vitro Expansion of Human Immunodeficiency Virus (HIV)-Specific T-Cell Responses bygagmRNA-Electroporated Dendritic Cells from Treated and Untreated HIV Type 1-Infected Individuals

“…Recently, we (47,48,61) and others (9,15,22,28,40,54,57) have shown that transfection with mRNA is more effective than mRNA lipofection, peptide pulsing, or viral transduction to generate primary (65) and memory (57) responses. Furthermore, we demonstrated that DC from treatment-naïve HIV-1-seropositive subjects can efficiently be transfected with HIV gag and env mRNA, derived either from consensus subtype B or autologous viral or proviral HIV, and that these DC readily trigger autologous CD4 ϩ and CD8 ϩ T cells to release IFN-␥ and IL-2 in a short-term ex vivo enzyme-linked immunospot (ELISPOT) assay (60).…”

High-Level Antigen Expression and Sustained Antigen Presentation in Dendritic Cells Nucleofected with Wild-Type Viral mRNA but Not DNA

“…Generation of the pSP73/GFP/A64 and pSP73/SIVmac239Gag/A64 plasmids and in vitro transcription of mRNA were performed as described previously (33). pSP73/SIVmac239Gag/A64 encodes a wild-type, non-codon-optimized Gag sequence isolated from a rhesus macaque 2 weeks postinfection with the SIVmac239 SIV isolate (33).…”

“…Generation of the pSP73/GFP/A64 and pSP73/SIVmac239Gag/A64 plasmids and in vitro transcription of mRNA were performed as described previously (33). pSP73/SIVmac239Gag/A64 encodes a wild-type, non-codon-optimized Gag sequence isolated from a rhesus macaque 2 weeks postinfection with the SIVmac239 SIV isolate (33). pSP73/SIVmac239Gag/ A64 was used as a template for the amplification of Gag by PCR using the following forward and reverse primers, respectively: pGagN1F, 5ЈGCGCTCGAGGCCAC CATGGGCGTGAG3Ј; and pGagN1R, 5ЈCGCGCGGCCGCTTACTTGCCCA ACTGCATGTAG 3Ј.…”

“…Recently, nucleofection has emerged as a superior method for the delivery of transgene to primary cell lines, including cytokine-induced killer cells, neurons, keratinocytes, macrophages, and DC (9,15,21,27,29,33,37,47). Nucleofection has been used primarily as a method of introducing DNA into cells as it is reported to deliver DNA directly into the nucleus, enhancing gene expression (17).…”

“…Nucleofection has been used primarily as a method of introducing DNA into cells as it is reported to deliver DNA directly into the nucleus, enhancing gene expression (17). However, recent studies suggest that nucleofection of DC with mRNA is an effective means of inducing high-level antigen expression (27,33). While conventional methods of gene delivery have been compared using monocyte-derived DC (41,51), a limited number of studies have employed the more-efficient process of nucleofection to evaluate DNA and mRNA delivery into these cells (27), and none to our knowledge have compared the capacity for mRNA-and DNA-nucleofected DC to stimulate antigenspecific T-cell responses.…”