Sam68 Promotes Hepatitis C Virus Replication by Interaction with Stem-Loop 2 of Viral 5′ Untranslated Region

Abstract

The Src-associated in mitosis 68-kDa (Sam68) protein is a highly conserved nuclear protein and is involved in a series of cellular processes, including transcription and signal transduction. Sam68 is comprised of 443 amino acids and contains an RGG box domain, a KH domain, and a tyrosine-rich domain. Its role in hepatitis C virus (HCV) replication is unknown. Here, we find that Sam68 promotes HCV replication without affecting viral translation. The RNA immunoprecipitation experiments show that the positive strand of HCV RNA interacts with Sam68. HCV infection triggers the translocation of the Sam68 protein from the nucleus to the cytoplasm, where it interacts with the HCV genome. Further study shows that the region of Sam68 spanning amino acids 1 to 157 is the pivotal domain to interact with the stem-loop 2 of the HCV 5= untranslated region (5= UTR) and is responsible for the enhancement of HCV replication. These data suggested that Sam68 may serve as a proviral factor of HCV to facilitate viral replication through interaction with the viral genome. IMPORTANCE Hepatitis C virus (HCV) is a member of the Flaviviridae family, and its infection causes chronic hepatitis, liver cirrhosis, and even hepatocellular carcinoma. No vaccine is available. Many host factors may be implicated in the pathogenesis of HCV-related diseases. This study discloses a new host factor that binds to the HCV 5= UTR and promotes HCV replication. Sam68 may play an important role in HCVrelated diseases, and further investigation is highly encouraged to explore its specific actions in HCV pathogenesis. FIG 4 Sam68 directly binds to HCV RNA. (A and B) Huh7.5 cells were infected with HCV at an MOI of 0.1 for 72 h. The cells were harvested and immunoprecipitated with control IgG or anti-Sam68 antibody or anti-PCBP2 antibody. (A) RNA was extracted from the precipitate complex and subjected to RT-PCR or qRT-PCR analysis. (B) Protein from the precipitate complex was detected by immunoblotting with the anti-Sam68 and PCBP2 antibodies. (C) Purified Sam68 protein (0.5 g) and in vitro transcribed JFH1 RNA (1 g) were incubated in binding buffer for 20 min at room temperature followed by RIP analysis. (D) Gel shift analysis of complex formation between 30 pmol of purified Sam68 protein and 10 pmol of in vitro transcribed JFH1 RNA. Arrows denote the positions of unbound RNA and RNA-Sam68 complexes. Qin et al.TABLE 3 Primers used for amplification of HCV genome fragments Fragment (size [bp]) Primer sequence (5=-3=) 3= UTR (236) CGGAATTCAGCGGCACACACTAGGTACA (forward, 9443-9462) GCTCTAGAACATGATCTGCAGAGAGACC (reverse, 9678-9659) 5= UTR (340) CGGAATTCACCTGCCCCTAATAGGGGCG (forward, 1-20) GCTCTAGAGGTGCACGGTCTACGAGACC (reverse, 340-321) SL1-3 (296) CGGAATTCACCTGCCCCTAATAGGGGCG (forward, 1-20) GCTCTAGAATCAGGCAGTACCACAAGGC (reverse, 296-277) SL2-4 (301) CGGAATTCCCCCTGTGAGGAACTACTGT (forward, 40-59) GCTCTAGAGGTGCACGGTCTACGAGACC (reverse, 340-321) SL3-4 (241) CGGAATTCGTCGTACAGCCTCCAGGCCC (forward, 100-119) GCTCTAGAGGTGCACGGTCTACGAGACC (reverse, 340-321) Qin et al.

Hepatitis C Viral Replication Complex

“…These proteins include La [ 166 ], hnRNP L [ 167 ], the NFAR protein complex (NF90, NF45, and RHA) [ 168 ], PTB [ 169 ], PCBP2 [ 168 ] and RNA binding protein 24 [ 170 ]. High-mobility group box 1 (HMGB1) interacting with SL 4 of 5’-UTR [ 171 ], Src-associated in mitosis 68-kDa (Sam68) protein binding with SL 2 of 5’-UTR [ 172 ], and heat shock cognate protein 70 (Hsc 70) interacting with poly-U/UC in the 3’-UTR [ 173 ] could also promote HCV replication.…”