SAT0036 Down-Regulated PGC-1β Could Inhibit RA-FLS Induced Osteoclastogenesis and Bone Resorption by Suppression of NF-κB Activation

Abstract

BackgroundPeroxisome proliferator-activated receptor-gamma coactivator-1beta (PGC-1β) is a transcriptional coactivator that plays important roles in regulating multiple aspects of energy metabolism and cytokine signaling pathways. We have reported that down-regulating PGC-1β alleviated the proinflammatory effect of rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLS). Recent study reported that osteoclast formation and bone resorption were markedly suppressed in PGC-1β knockout mice. However, the role of PGC-1β on the osteoclastogenesis in RA has not yet been illuminated.ObjectivesTo investigate the effect and underlying mechanism of PGC-1β on RA-FLS induced osteoclastogenesis and bone resorptionMethodsSynovium was obtained from 3 active RA patients and cultured RA-FLS was identified by flow cytometry using CD55 antibody. RAW264.7, used as precursor of osteoclast, was cocultured with RA-FLS or human RANKL. Gene knockdown was performed by lentivirus short hairpin RNAs (sh-RNAs) which were cloned into pLKO.1 (GV248) lentiviral vectors. The sh-PGC-1β targeting sequence was GGAGGAGGAAGAAGAAGAATT, while sh-GFP was regarded as negative control. Culture supernatants containing sh-RNA were added to RAW264.7 in the presence of polybrene. Stable cell lines were validated by western blot. RAW264.7 transfected with sh-PGC-1β or sh-GFP was cocultured with RA-FLS in 6 well-plates with transwell plates. At day 14, osteoclasts were identified as multinucleated cells that contained >3 nuclei with positive staining of tartrate-resistant acid phosphatase (TRAP), and protein of RAW264.7 and osteoclasts was extracted for western blot determining the phosphorylation of ERK, JNK, p38 and NF-κB. At day 21, resorption lacunae area was identified by toluidine blue staining and measured by image analysis system.Results(1) Flow cytometry results showed the purity of cultured FLS was over 90%. TRAP staining showed osteoclast formation in both cocultrue system of RAW264.7 with RA-FLS or human RANKL.(2) The protein expression of PGC-1β in RAW264.7 transfected with sh-PGC-1β was hardly detected compared with negative control (Fig. 1C). At day 14, down-regulating PGC-1β of RAW264.7 cells could significantly decrease the number of osteoclasts compared with negative control [(1037±356) vs (237±110) per well, P=0.021, Fig. 1A]. At day 21, down-regulating PGC-1β of RAW264.7 cells could significantly inhibit the resorption lacunae area on bone slices compared with negative control [(25.33±6.50) % vs (10.67±5.51) %, P=0.041, Fig.1B].(3) The protein expression of p-NF-κB from RAW264.7 and osteoclasts was significantly down-regulated in sh-PGC-1β transfected group than sh-GFP transfected group, but not p-ERK, p-JNK or p-p38 (Fig. 1C).ConclusionsOur results implied that down-regulated PGC-1β could inhibit RA-FLS induced osteoclastogenesis and bone resorption by suppression of NF-κB activation.AcknowledgementsSupported by Grant support was provided: National Natural Science Foundation of China (81471597), Specialized Research Fund for the Doctoral ...