Scaling laws indicate distinct nucleation mechanisms of holes in the nuclear lamina

Deviri, Dan; Pfeifer, Charlotte R.; Dooling, Lawrence J.; Ivanovska, Irena L.; Discher, Dennis E.; Safran, S. A.

doi:10.1038/s41567-019-0506-8

Cited by 30 publications

(27 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…RFP-NLS is nuclear when the membrane is intact; on rupture, it is visible in the cytoplasm as a diffuse signal that is initially brightest proximal to the rupture site, and it is reimported into the nucleus as nucleus integrity is restored (Supplemental Movie S1). Nucleus rupture is frequently accompanied by a quantifiable decrease in nuclear RFP-NLS intensity and the proportion decrease is defined as the rupture extent ( Denais et al , 2016 ; Raab et al , 2016 ; Deviri et al , 2019 ; Zhang et al , 2019 ). To compare repair kinetics between control and LMNB1-depleted cells, analysis was limited to ruptures of similar extents in both populations to control for the duration of RFP-NLS reimport.…”

Section: Resultsmentioning

confidence: 99%

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

Young

Gunn

Hatch

2020

MBoC

View full text Add to dashboard Cite

show abstract

Section: Resultsmentioning

confidence: 99%

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

Young

Gunn

Hatch

2020

MBoC

View full text Add to dashboard Cite

show abstract

“…When the membrane ruptures, RFP-NLS becomes visible in the cytoplasm and its intensity in the nucleus decreases. The site where cytoplasmic RFP-NLS first appears marks the site of nuclear membrane rupture and the degree of RFP-NLS loss defines the extent of the rupture, which is indicative of the size of the membrane gap (Denais et al, 2016;Raab et al, 2016;Deviri et al, 2019;Zhang et al, 2019). During rupture, RFP-NLS is continually diffusing out of the membrane gap and being reimported by nuclear pores around the rest of the membrane.…”

Section: Resultsmentioning

confidence: 99%

“…Smaller ruptures are associated with smaller membrane holes (Denais et al, 2016;Zhang et al, 2019), and repair faster in our assays (Figure 1). The physical size of these holes could necessitate different mechanisms of membrane repair or correlate with different mechanisms of membrane instability, such as local detachment from an intact lamina versus expansion at the site of chromatin herniation through a lamina gap (Deviri et al, 2019). Alternatively, the BAF-independent repair mechanism could be the same as the BAF dependent one, just slower due to a reliance on the ability of NETs to bind DNA and chromatin directly (Barton et al, 2015).…”

Section: Resultsmentioning

confidence: 99%

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

Young

Gunn

Hatch

2020

Preprint

View full text Add to dashboard Cite

Nuclear membrane rupture during interphase occurs in a variety of cell contexts, both healthy and pathological. In the primary nucleus, membrane ruptures are rapidly repaired but the mechanisms are still unclear. Here we show that BAF, a nuclear envelope protein that shapes chromatin and recruits additional NE proteins in mitosis, also facilitates nuclear membrane repair in interphase, in part through recruitment of the nuclear membrane proteins emerin and LEMD2 to rupture sites. Using a cancer cell line depleted of lamin B1 to drive membrane rupture, we confirmed that GFP-BAF accumulates at rupture sites and found that BAF depletion increased the duration of nucleus integrity loss after rupture, with the largest effects being on longer ruptures. This phenotype could be rescued by WT BAF, but not by a mutant lacking the LEM-protein binding domain. Depletion of LEMD2 or emerin, but not lamin A/C, was sufficient to significantly increase the proportion of long ruptures, consistent with LEM-protein binding being a key function of BAF during membrane repair. Overall our results suggest a membrane repair model where BAF facilitates the repair of large membrane ruptures, in part by recruiting transmembrane nuclear envelope proteins, but where small ruptures are repaired by a BAF-independent mechanism.Construction of stable cell lines U2OS RFP-NLS cells were made by transfecting U2OS cells with 2xRFP-NLS, selecting with 0.5 mg/ml G418 and collecting the RFP+ population by FACS. U2OS RFP-NLS EGFP-BAF shLmnB1 cells were made by infecting U2OS RFP-NLS cells with lentiviruses containing pLKO.1 shRNA-LmnB1.71 or EGFP-BAF-IRES-Blast vectors, selecting with10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) and sorting for RFP/GFP double positive cells by FACS. PlasmidsAll plasmids encoding EGFP-BAF (EGFP-BAF_WT, EGFP-BAF_L58R, EGFP-BAF_G47E and EGFP-BAF_G25E) were a gift from the Gerlich lab (IMBA, Vienna, Austria) and described in (Samwer et al., 2017). The EGFP-BAF-IRES-Blast cassettes are expressed under the control of a crippled EF1α promoter. EGFP-IRES-Blast was generated by digesting EGFP-BAF_WT with XbaI and BamHI to remove EGFP-BAF inserting and EGFP-only was PCR'd and inserted via sequence-and ligation-independent cloning (SLiC). Lamin B shRNAs were expressed from the lentiviral plasmid pLKO.1 shRNA-LmnB1.71 puro (SHCLND-NM_005573, Sigma-Aldrich). The sequence of the lamin B1 shRNA is 5′ CCGGGCATGAGAATTGAGAGCCTTTCTCGAGAAAGGCTCTCAATTCTCATGCTTTTT-3′. 2xRFP-NLS (RFP-NLS) was described previously (Hatch et al., 2013) and made by recombination of a PCR of TagRFP (Evrogen) fused to a C-terminal NLS (PPKKKRKV) into the Gateway vector pDONOR20 and recombining into pcDNA-DEST53-mCherry to generate mCherry-TagRFP-NLS. siRNA transfection All siRNA transfections were performed using siLentFect (Bio-Rad) according to manufacturer's instructions. Custom siRNAs (Dharmacon) against human BAF (#1. 5′-AGUUUCUGGUGCUAAAGAAtt-3′, #2. 5′-CCCUCACUUUCAAUCCGUUuu-3′), lamin A/C (5′-GGUGGUGACGAUCUGGGCUuu-3′)(Harada et al., 2...

show abstract

“…Extreme nuclear deformations during migration through micro-channels or pores have been shown to cause plastic deformation [18,19] as well as nuclear membrane rupture [18][19][20][21][22][23]. Whether or not nuclear plasticity and nuclear damage are inter-related remains unknown.…”

Section: Introductionmentioning

confidence: 99%

Nuclear plasticity increases susceptibility to damage during confined migration

et al. 2020

View full text Add to dashboard Cite

Large nuclear deformations during migration through confined spaces have been associated with nuclear membrane rupture and DNA damage. However, the stresses associated with nuclear damage remain unclear. Here, using a quasi-static plane strain finite element model, we map evolution of nuclear shape and stresses during confined migration of a cell through a deformable matrix. Plastic deformation of the nucleus observed for a cell with stiff nucleus transiting through a stiffer matrix lowered nuclear stresses, but also led to kinking of the nuclear membrane. In line with model predictions, transwell migration experiments with fibrosarcoma cells showed that while nuclear softening increased invasiveness, nuclear stiffening led to plastic deformation and higher levels of DNA damage. In addition to highlighting the advantage of nuclear softening during confined migration, our results suggest that plastic deformations of the nucleus during transit through stiff tissues may lead to bending-induced nuclear membrane disruption and subsequent DNA damage.

show abstract

Scaling laws indicate distinct nucleation mechanisms of holes in the nuclear lamina

Cited by 30 publications

References 39 publications

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

BAF facilitates interphase nuclear membrane repair through recruitment of nuclear transmembrane proteins

Nuclear plasticity increases susceptibility to damage during confined migration

Contact Info

Product

Resources

About