Simple Cloning via Direct Transformation of PCR Product (DNA Multimer) to Escherichia coli and Bacillus subtilis

Abstract

We developed a general restriction enzyme-free and ligase-free method for subcloning up to three DNA fragments into any location of a plasmid. The DNA multimer generated by prolonged overlap extension PCR was directly transformed in Escherichia coli [e.g., TOP10, DH5␣, JM109, and BL21(DE3)] and Bacillus subtilis for obtaining chimeric plasmids.T he limited choices of restriction enzymes, relatively low efficiencies in digestion and ligation, and possible self-ligation of the digested plasmid may result in difficulties in constructing chimeric plasmids. Recently, several companies have developed recombinase-based technologies, such as the Invitrogen Gateway cloning technology, Clontech In-Fusion, BioCat Cold-Fusion, and Red/ET Recombination, but these rely heavily on specialized kits containing vectors, enzymes, or hosts (4,7,10,11,14,15 Downloaded fromSeveral overlap extension PCR-based methods were developed for subcloning. However, RF cloning (9) and overlap extension PCR cloning (2) require DpnI to digest the vector template. Additionally, the maximum inserted DNA length is ϳ6.7 kb (2). Another technology, called "Quick Assemble," has low positive cloning efficiencies, ϳ33% (16). We developed a sequence-independent "simple cloning" method without the need for restriction and ligation enzymes. The protocol includes three steps ( Fig. 1): (i) linear DNA fragments (i.e., inserted DNA fragment and vector backbone), both of which contained 3= and 5= 40-to 50-bp overlapping termini, are generated by high-fidelity PCR with the New England BioLabs (NEB) Phusion polymerase (Ipswich, MA); (ii) the DNA multimer is generated based on these DNA templates by prolonged overlap extension PCR (POE-PCR) with Phusion polymerase; and (iii) the POE-PCR products (DNA multimer) are transformed into competent Escherichia coli or Bacillus subtilis strains directly, yielding the desired chimeric plasmid. A 1.3-kb insertion fragment (Cherry-cbm17) encoding a cherry fluorescent protein and a family 17 carbohydrate-binding module from Clostridium cellulovorans cellulase 5A (1) was subcloned into a 3.6-kb pET20b vector backbone, yielding a 4.9-kb plasmid, pET20b-cherry-cbm17, where the fusion protein was controlled by a T7 promoter. A linear vector backbone was amplified by using the forward primer VF (5=TAGCCTGGACAA TATCAAATTTACCCTCGAGCACCACCACCACCACCACT3=) and the reverse primer VR (5=TATCCTCCTCGCCCTTGCTCA CCATATGTATATCTCCTTCTTAAAGTTAA3=). VF and VR contain the last 25 bp of the 3= terminus of the insertion sequence (underlined) and the first 25 bp of the 5= terminus of the vector sequence (bold). Similarly, the insertion fragment was amplified by primers IF (5=TTAACTTTAAGAAGGAGATATACATATGG TGAGCAAGGGCGAGGAGGAT3=) and IR (5=AGTGGTGGTG GTGGTGGTGCTCGAGGGTAAATTTGATATTGTCCAGGCT A3=). IF and IR have the reverse complementary sequences of VR and VF, respectively. The standard extension time (SET) in PCR was calculated based on the amplified fragment length divided by 3 kb/min for Phusion polymerase at 72°C. Two linearized DNA fragments were ...

Engineering an iterative polyketide pathway in Escherichia coli results in single-form alkene and alkane overproduction

“…Primers Promoter-F and Promoter-R were used to amplify the various synthesized promoters, and primers Vector-F and Vector-R were used to amplify pET28a. The corresponding fragments were treated using simple cloning methods (You et al, 2012) to generate pET28a-derived vectors with altered promoters named pET28-LacUV5, pET28-LacO1, pET28-TacI, and pET28-TacII, respectively. The fragment of sgcE10 digested with NdeI/XhoI was inserted into the four above-mentioned pET28a-derived vectors, yielding sgcE10 constructs with various promoter strengths named pLacUV5, pLacO1, pTacI and pTacII.…”

Multimer recognition and secretion by the non-classical secretion pathway in Bacillus subtilis

“…The recombinant plasmids were generated using a general restriction enzyme-free and ligase-free method58. The pMAR plasmid, a derivative of the E. coli/B.…”

Coenzyme Engineering of a Hyperthermophilic 6-Phosphogluconate Dehydrogenase from NADP+ to NAD+ with Its Application to Biobatteries

“…pET20b vector backbone was amplified with a primer pair of 6PGDH_VF and 6PGDH_VR. Plasmid pET20b- 6pgdh based on the two DNA fragments was obtained using a Simple Cloning method38.…”