Sinapic Acid Attenuated Cardiac Remodeling After Myocardial Infarction by Promoting Macrophage M2 Polarization Through the PPARγ Pathway

Abstract

BackgroundMacrophage polarization is an important regulatory mechanism of ventricular remodeling. Studies have shown that sinapic acid (SA) exerts an anti-inflammatory effect. However, the effect of SA on macrophages is still unclear.ObjectivesThe purpose of the study was to investigate the role of SA in macrophage polarization and ventricular remodeling after myocardial infarction (MI).MethodsAn MI model was established by ligating the left coronary artery. The rats with MI were treated with SA for 1 or 4 weeks after MI. The effect of SA on bone marrow-derived macrophages (BMDMs) was also observed in vitro.ResultsCardiac systolic dysfunction was significantly improved after SA treatment. SA reduced MCP-1 and CCR2 expression and macrophage infiltration. SA decreased the levels of the inflammatory factors TNF-α, IL-1α, IL-1β, and iNOS and increased the levels of the M2 macrophage markers CD206, Arg-1, IL-10, Ym-1, Fizz-1, and TGF-β at 1 week after MI. SA significantly increased CD68+/CD206+ macrophage infiltration. Myocardial interstitial fibrosis and MMP-2 and MMP-9 levels were decreased, and the sympathetic nerve marker TH and nerve sprouting marker GAP43 were suppressed after SA treatment at 4 weeks after MI. The PPARγ level was notably upregulated after SA treatment. In vitro, SA also increased the expression of PPARγ mRNA in BMDMs and IL-4-treated BMDMs in a concentration-dependent manner. SA enhanced Arg1 and IL-10 expression in BMDMs, and the PPARγ antagonist GW9662 attenuated M2 macrophage marker expression.ConclusionsOur results demonstrated that SA attenuated structural and neural remodeling by promoting macrophage M2 polarization via PPARγ activation after MI.

Sinapic Acid Attenuate Liver Injury by Modulating Antioxidant Activity and Inflammatory Cytokines in Thioacetamide-Induced Liver Cirrhosis in Rats

“…Similarly, studies have reported the TAA efficacy in changing the weightage of the body and bulky liver formation in various rat trials [4,42,43]. These body/liver weightage modulations were almost normalized in SA-treated rats, which could be correlated with the dyslipidemia [44], anti-inflammatory [45], and antioxidant [46] bioactivities of SA as reported by previous researchers. Similarly, researchers have reported the SA efficacy in restoring the body and liver weightage to normal in dimethylnitrosamine (DMN)-induced chronic liver damage in rats [47].…”

Electroacupuncture Improves Cardiac Function via Inhibiting Sympathetic Remodeling Mediated by Promoting Macrophage M2 Polarization in Myocardial Infarction Mice

“…Heart tissue below the ligature line was removed and immersion-fixed in 4% paraformaldehyde for histological study. The heart is innervated by sympathetic, parasympathetic, and sensory fibers, of which sympathetic nerves are usually stained by TH [ 18 , 39 ]. Paraffin blocks of heart tissue were processed and cut into 4- μ m sections for immunohistochemistry for TH (1 : 2,000, CST, USA), and together with GAP43 [ 19 , 32 ] (1 : 200, Immunoway, USA), these two antibodies were used to assess cardiac sympathetic innervation.…”

“…Studies have shown that depleting macrophages using clodronate can reduce NGF levels in myocardial tissue, preventing excessive sympathetic innervation and improving myocardial electrical remodeling in the peri-infarct region [ 11 , 16 ]. Furthermore, promoting macrophage M2 polarization has been found to significantly decrease NGF levels [ 17 , 18 , 19 , 20 ]. Currently, macrophages are generally categorized as pro-inflammatory M1 or anti-inflammatory M2 macrophages.…”

Effect of Low-Intensity Pulsed Ultrasound on Macrophage Properties and Fibrosis in the Infrapatellar Fat Pad in a Carrageenan-Induced Knee Osteoarthritis Rat Model

“…The oligonucleotides were synthesized using Gene Design (Suita, Japan). The primer sequences used were obtained from previous studies [10,[31][32][33] and are listed in Table 1.…”

“…GGGTTCCATGGTGAAGTCAAC CACCTCTCAAGCAGAGCACAG [31] iNOS AGCATCCACGCCAAGAACG GTCTGGTTGCCTGGGAAAAT [32] IL-10 ACTGCTATGTTGCCTGCTCTTAC CAGTAAGGAATCTGTCAGCAGTATG [32] Arg1 ATTGGCAAAGTGATGGAAGAGAC CAAGACAAGGTCAACGCCAC [32] TGF-β AGAAGTCACCCGCGTGCTAAT CACTGCTTCCCGAATGTCTGA [33] Col 1a2 GCTTTGTGGATACGCGAACTC CCAGCATTGGCATGTTGCT [33] HRPT TGTTTGTGTCATCAGCGAAAGTG ATTCAACTTGCCGCTGTCTTTTA [10] TABLE 1: Primers designed for real-time PCR.…”