SLEEPLESS Is a Bifunctional Regulator of Excitability and Cholinergic Synaptic Transmission

Abstract

Summary Background Although sleep is conserved throughout evolution, the molecular basis of its control is still largely a mystery. We previously showed that the quiver/sleepless (qvr/sss) gene encodes a membrane-tethered protein that is required for normal sleep in Drosophila. SLEEPLESS (SSS) protein functions, at least in part, by upregulating the levels and open probability of Shaker (Sh) potassium channels to suppress neuronal excitability and enable sleep. Consistent with this proposed mechanism, loss-of-function mutations in Sh phenocopy qvr/sss null mutants. However, sleep is more genetically modifiable in Sh than in qvr/sss mutants, suggesting that sss may regulate additional molecules to influence sleep. Results Here we show that SSS also antagonizes nicotinic acetylcholine receptors (nAChRs) to reduce synaptic transmission and promote sleep. Mimicking this antagonism with the nAChR inhibitor mecamylamine or by RNAi knockdown of specific nAChR subunits is sufficient to restore sleep to qvr/sss mutants. Regulation of nAChR activity by SSS occurs post-transcriptionally since the levels of nAChR mRNAs are unchanged in qvr/sss mutants. Regulation of nAChR activity by SSS may in fact be direct, since SSS forms a stable complex with and antagonizes fly nAChR function in transfected cells. Intriguingly, lynx1, a mammalian homolog of SSS, can partially restore normal sleep to qvr/sss mutants, and lynx1 can form stable complexes with Shaker-type channels and nAChRs. Conclusions Together, our data point to an evolutionarily conserved, bi-functional role for SSS and its homologs in controlling excitability and synaptic transmission in fundamental processes of the nervous system such as sleep.

Molecular Mechanisms of Sleep Homeostasis in Flies and Mammals

“…Mutations in the Shaker potassium channel (Cirelli et al 2005a) and its activators Hyperkinetic (Bushey et al 2007) and sleepless (sss) Wu et al 2010) are predicted to increase excitability dramatically and reduce sleep. Notably reduced sleep in sss mutants can be rescued by expression in cholinergic neurons (Wu et al 2014). Interestingly, sss, but not Sh mutants (Cirelli et al 2005a), show impaired rebound sleep , suggesting that sss may regulate other factors.…”

“…Interestingly, sss, but not Sh mutants (Cirelli et al 2005a), show impaired rebound sleep , suggesting that sss may regulate other factors. SSS also interacts with and suppresses the activity of nicotinic acetylcholine receptors to promote sleep (Wu et al 2014). On the other hand, the nicotinic acetylcholine receptor a subunit redeye (rye) interacts with SSS to promote sleep (Shi et al 2014), suggesting that cholinergic signaling can impact sleep in both directions.…”

Mechanisms of Inhibition and Potentiation of α4β2 Nicotinic Acetylcholine Receptors by Members of the Ly6 Protein Family

“…␣4-HA was generated by PCR amplifying ␣4 from GFP-␣4-pciNeo (gift from Dr. H. Lester) with the following primers (5Ј-3Ј): F: AAAAGCTTACCATGGAGATCGGGGGCTCCG; R: TCTAGAGAGCTAGGTGCCGCTATTCC and subcloned into pcDNA3 in-frame with a C-terminal hemagglutinin (HA) tag (36) between the HindIII and Xba1 sites.…”

Pleiotropic Effects of Loss of the Dα1 Subunit in Drosophila melanogaster: Implications for Insecticide Resistance

“…While activation of all cholinergic neurons inhibits sleep in flies (Seidner et al 2015), different neuronal groups can be wake-promoting (Yi et al 2013) or sleep-promoting (Wu et al 2014). Individual nAChR subunits also appear to have different roles in sleep regulation (Yi et al 2013;Shi et al 2014;Wu et al 2014).…”

“…melanogaster has 10 nAChR subunits; however, only three of these have been associated with behavioral phenotypes, with specific roles described for Da7 in the escape response (Fayyazuddin et al 2006) and for both Da3 and Da4 in sleep behavior (Shi et al 2014;Wu et al 2014). Mutations in three D. melanogaster nAChR subunits confer resistance to two important classes of insecticides; Da1 and Db2 to neonicotinoids (Perry et al 2008), and Da6 to spinosyns (Perry et al 2007Watson et al 2010;Somers et al 2015).…”