Small Interfering Double-Stranded RNAs as Therapeutic Molecules to Restore Chemosensitivity to Thymidylate Synthase Inhibitor Compounds

Schmitz, John C.; Chen, Tian Min; Chu, Edward

doi:10.1158/0008-5472.can-03-1203

Cited by 38 publications

(47 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In contrast, Schmitz et al 29 observed only a minor (25-30%) inhibition of proliferation when RKO human colon cancer cells were transiently transfected with siRNA corresponding to the same sequence targeted by the TS965 retrovirus. This might indicate that delivery of the siRNA was more effective in cells stably expressing a gene encoding the siRNA than in cells transiently transfected with the siRNA.…”

Section: Discussionmentioning

confidence: 89%

“…The siRNA approach has several advantages over the use of chemotherapeutic drugs to reduce TS enzyme activity. For example, the siRNA approach avoids the potential problem of TS overproduction due to drug-induced disruption of TS translational autoregulation 10,29 or enzyme stabilization, 9 since the mRNA itself is destroyed. Furthermore, singlepoint mutations in the siRNA target sequence are not likely to protect the TS mRNA from destruction (Figure 1a), although minor sequence changes can lead to significant levels of resistance to chemotherapeutic drugs.…”

Section: Discussionmentioning

confidence: 99%

“…However, Schmitz et al 29 showed that a partial siRNA-mediated reduction of TS expression led to increased sensitivity of the cells to drugs that target the enzyme. Koehler and Ladner 30 recently showed that an siRNA-mediated decrease in dUTPase expression led to a substantial expansion of the cellular dUTP pool, as well as increased sensitivity of the cells to TS enzyme inhibitors.…”

Section: Discussionmentioning

confidence: 99%

“…Previous studies using TS enzyme inhibitors 28 indicated that greater than 95% inhibition of TS activity was necessary to observe a significant effect on cell proliferation. Recently, Schmitz et al 29 identified another TS mRNA sequence downstream of the translational termination codon (965-983 nt relative to the A of the translational start codon) that can be effectively targeted by siRNA. To determine if this sequence was more effective than the TS898 sequence, we inserted a gene encoding the alternative siRNA sequence (Table 1) into the pRS plasmid to form pRS-TS965.…”

Section: Identification Of An Effective Sirna Target Sequencementioning

confidence: 99%

See 3 more Smart Citations

Stable inhibition of human thymidylate synthase expression following retroviral introduction of an siRNA gene

et al. 2005

View full text Add to dashboard Cite

Thymidylate synthase (TS) is an essential enzyme that synthesizes thymidylic acid in the de novo biosynthetic pathway. Inhibiting TS enzyme activity with substrate or cofactor analogs leads to inhibition of DNA replication and cell death. For this reason, TS is an important target enzyme for cancer chemotherapeutic drugs. We describe an alternative approach to reducing cellular TS enzyme activity using short interfering RNA (siRNA) technology to lower TS mRNA levels. Plasmids that direct the synthesis of siRNAs that target nucleotides 898-916 and 965-983 (relative to the A of the translational start codon) of human TS mRNA were highly effective at reducing TS enzyme levels in transient transfection assays. Infection of HeLa cells with retroviruses that contain the effective siRNA genes led to a stable 80-95% reduction of TS enzyme and mRNA. A similar percent reduction in TS expression was observed in a cell line that overproduces TS enzyme 100-fold due to TS gene amplification. Cells that exhibited the greatest reduction in TS enzyme level grew poorly in medium that lacked thymidine. These observations suggest that siRNA approaches may provide an alternative therapeutic strategy to reduce TS enzyme levels.

show abstract

Section: Discussionmentioning

confidence: 89%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Identification Of An Effective Sirna Target Sequencementioning

confidence: 99%

See 2 more Smart Citations

Stable inhibition of human thymidylate synthase expression following retroviral introduction of an siRNA gene

et al. 2005

View full text Add to dashboard Cite

show abstract

“…In addition, a control siRNA duplex, GL2, was obtained from Dharmacon. The procedure of transfection of siRNA into cells was as described previously (Schmitz et al, 2004). For ATP7A silencing, human ATP7A siRNA ON-TARGET plus SMART pool (mixed four duplex: CAGAAACGAUAAUACGA UUUU; GAUAAACGCUCCCUAAACAUU; GGUAUUAGCUGUAA AGUCAUU; GCAAAGGAGUCCAUCAUAUUU, Dharmacon) has been used in this study.…”

Section: Silencing Of Ts and Atp7a By Small Interfering Rna Transfectionmentioning

confidence: 99%

Combined modalities of resistance in an oxaliplatin-resistant human gastric cancer cell line with enhanced sensitivity to 5-fluorouracil

Chen

Tsou

et al. 2007

Br J Cancer

View full text Add to dashboard Cite

To identify mechanisms underlying oxaliplatin resistance, a subline of the human gastric adenocarcinoma TSGH cell line, S3, was made resistant to oxaliplatin by continuous selection against increasing drug concentrations. Compared with the parental TSGH cells, the S3 subline showed 58-fold resistance to oxaliplatin; it also displayed 11-, 2-, and 4.7-fold resistance to cis-diammine-dichloroplatinum (II) (CDDP), copper sulphate, and arsenic trioxide, respectively. Interestingly, S3 cells were fourfold more susceptible to 5-fluorouracilinduced cytotoxicity due to downregulation of thymidylate synthase. Despite elevated glutathione levels in S3 cells, there was no alteration of resistant phenotype to oxaliplatin or CDDP when cells were co-treated with glutathione-depleting agent, l-buthionine-(S,R)-sulphoximine. Cellular CDDP and oxaliplatin accumulation was decreased in S3 cells. In addition, amounts of oxaliplatin-and CDDP -DNA adducts in S3 cells were about 15 and 40% of those seen with TSGH cells, respectively. Western blot analysis showed increased the expression level of copper transporter ATP7A in S3 cells compared with TSGH cells. Partial reversal of the resistance of S3 cells to oxaliplatin and CDDP was observed by treating cell with ATP7A-targeted siRNA oligonucleotides or P-type ATPaseinhibitor sodium orthovanadate. Besides, host reactivation assay revealed enhanced repair of oxaliplatin-or CDDP-damaged DNA in S3 cells compared with TSGH cells. Together, our results show that the mechanism responsible for oxaliplatin and CDDP resistance in S3 cells is the combination of increased DNA repair and overexpression of ATP7A. Downregulation of thymidylate synthase in S3 cells renders them more susceptible to 5-fluorouracil-induced cytotoxicity. These findings could pave ways for future efforts to overcome oxaliplatin resistance.

show abstract

Genetic determinants for activated fluoropyrimidine chemotherapy

Gmeiner

2006

Drug Development Research

View full text Add to dashboard Cite

Fluoropyrimidines (FPs) remain widely used for the treatment of diverse malignancies more than four decades following the initial report of 5-fluorouracil (5FU), the archetypal FP, as a novel compound with potential anti-neoplastic activity. Subsequent decades of research have enriched our understanding of the biochemical mechanisms that are important for FP activation as well as the genetic determinants that are predictive of the likely success, or failure, of FP chemotherapy for a particular individual. The concept that chemotherapy should be customized to complement the genetic profiles of cancer patients has become increasingly important as genotyping of tumor samples has become possible and as the number of available anticancer drugs has increased. Significant progress has been made in identifying the gene expression profiles for cancer patients who are likely to benefit from treatment with FPs. In this review, we will summarize the results of retrospective clinical studies correlating response to FP chemotherapy with the expression of specific genes, such as TS and DPD. We will also present a summary of FPs in current clinical use, including orally bioavailable FPs such as capecitabine, as well as FPs that are in pre-clinical development, such as FdUMP [10]. Refinement of a target population through pharmacogenetic analysis and development of novel FPs that evoke very high response rates in this target population will likely result in the use of FP regimens in the coming era when cancer becomes a largely manageable disease. Drug Dev.

show abstract

Small Interfering Double-Stranded RNAs as Therapeutic Molecules to Restore Chemosensitivity to Thymidylate Synthase Inhibitor Compounds

Cited by 38 publications

References 32 publications

Stable inhibition of human thymidylate synthase expression following retroviral introduction of an siRNA gene

Stable inhibition of human thymidylate synthase expression following retroviral introduction of an siRNA gene

Combined modalities of resistance in an oxaliplatin-resistant human gastric cancer cell line with enhanced sensitivity to 5-fluorouracil

Genetic determinants for activated fluoropyrimidine chemotherapy

Contact Info

Product

Resources

About