Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element

Abstract

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.

The Transcription Termination Region of the Adenovirus 2 Major Late Transcript Contains Multiple Functional Elements

“…Furthermore, no significant secondary structures could be deduced from the known sequence. Similar A-rich motifs have been identified in other transcription termination regions (Frayne & Kellems, 1986;Citron et al, 1984). Nuclear RNA from Ad2-infected cells contains a major 3' end that adjoins nt 620 of the termination region.…”

“…This is probably due to limited translation of the unpolyadenylated CAT RNA. It is possible that upon deletion of a transcription termination element, transcription proceeds through the polyadenylation site (Frayne & Kellems, 1986) and a second element, such as that found in the human lymphokine gene GM-CSF (Shaw & Kamen, 1986) to generate an unstable mRNA. Although this possibility cannot be ruled out, it is unlikely that the deletion mutants pl to p6 and pl0 to p19 generate CAT mRNAs of near equal instability.…”

“…The entire sequence of the last 10~ of the Ad2 genome has previously been determined by Herisse et al (1981). In order to identify possible DNA sequence motifs repeated throughout the termination region, a homology matrix was obtained comparing the sequences from nt 580 to 650 to the entire sequence from nt 1 to 1010, as shown in (Frayne & Kellems, 1986)• t Nucleotide number starts at an XbaI site 600 bp downstream of the polyadenylation signal (Citron et al, 1984)• sequence motif exists, present twice in the sequence from nt 580 to 650 and at least 10 times in the sequence from nt 1 to 1010. Furthermore, the sequence is not found between nt 900 and nt 1010.…”

“…Interestingly, similar sequences containing CCAC can be found in the transcription termination region of the mouse dihydrofolate reductase (DHFR) (Frayne & Kellems, 1986) gene and the mouse #-major globin gene (Citron et al, 1984). A-rich motifs containing CAGC are present in mouse DHFR and mouse #-globins.…”

A functional mRNA polyadenylation signal is required for transcription termination by RNA polymerase II.

“…Experiments in other systems have provided evidence consistent with each of these ideas. In the h u m a n gastrin gene it appears that termination may occur at a single site (Back et al 1986;Sato et al 1986), whereas transcription of the mouse [3-globin (Citron et al 1984), dihydrofolate reductase (Frayne and Kellems 1986), and oL-amylase (Hagenbuchle et al 1984)probably occurs at multiple sites located within regions of several hundred base pairs. In contrast, no specific sites of termination have been detected during transcription of the polyoma virus late strand, and it has been suggested that termination of polyoma late transcription occurs at essentially random sites (Acheson 1984).…”