Structure and expression profiling of a novel calcium-dependent protein kinase gene, CDPK3a, in leaves, stems, grapes, and cell cultures of wild-growing grapevine Vitis amurensis Rupr.

Abstract

KEY MESSAGE : VaCDPK3a is actively expressed in leaves, stems, inflorescences, and berries of Vitis amurensis and may act as a positive growth regulator, but is not involved in the regulation of resveratrol biosynthesis. Calcium-dependent protein kinases (CDPKs) are known to play important roles in plant development and defense against biotic and abiotic stresses. It has previously been shown that CDPK3a is the predominant CDPK transcript in cell cultures of wild-growing grapevine Vitis amurensis Rupr., which is known to possess high resistance against environmental stresses and to produce resveratrol, a polyphenol with valuable pharmacological effects. In this study, we aimed to define the full cDNA sequence of VaCDPK3a and analyze its organ-specific expression, responses to plant hormones, temperature stress and exogenous NaCl, and the effects of VaCDPK3a overexpression on biomass accumulation and resveratrol content in V. amurensis calli. VaCDPK3a was actively expressed in all analyzed V. amurensis organs and tissues and was not transcriptionally regulated by salt and temperature stresses. The highest VaCDPK3a expression was detected in young leaves and the lowest in stems. A reduction in the VaCDPK3a expression correlated with a lower rate of biomass accumulation and higher resveratrol content in calli of V. amurensis under different growth conditions. Overexpression of the VaCDPK3a gene in the V. amurensis calli significantly increased cell growth for a short period of time but did not have an effect on resveratrol production. Further subculturing of the transformed calli resulted in cell death and a decrease in expression of the endogenous VaCDPK3a. The data suggest that while VaCDPK3a acts as a positive regulator of V. amurensis cell growth, it is not involved in the signaling pathway regulating resveratrol biosynthesis and resistance to salt and temperature stresses.

Influence of overexpression of stilbene synthase VaSTS7 gene on resveratrol production in transgenic cell cultures of grape Vitis amurensis Rupr.

“…It was obtained by Agrobacte rium mediated transformation with a binary vector carrying the kanamycin resistance gene. The resulting cell line KA O had the same phenotype as the original cell culture V2 [18].…”

“…The selection of trans genic cells was performed by selection on kanamycin (10-15 mg/L) for three months. The produced trans genic lines were determined with primers 5'GAGGC TATTCGGCTATGACTG and 5'ATCGGGAGCG GCGATACCGTA by the presence of nptII gene inser tion under the conditions described in [18]. PCR for the virB2 gene was performed with primers 5'AAT GCGCGTGATATCGAGCTGCG and 5'ATACTAC CGCCAGTGAGCGTTTGG.…”

“…Agrobacterium mediated transformation by the previously described method was used to obtain VaSTS7 transgenic cell lines of grape V. amurensis [18]. After transformation, calli were cultured for four weeks in the presence of 250 mg/L cefotaxime in order to inhibit Agrobacterium growth.…”

Stilbene content and expression of stilbene synthase genes in cell cultures of Vitis amurensis treated with cinnamic and caffeic acids

“…Total RNA isolation was performed using hexadecyltrimethylammoniumbromide‐based extraction as descried in . Complementary DNAs were synthesized as described previously .…”

Regulation of stilbene biosynthesis in plants

“…Application of a calmodulin antagonist, N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide (W7), which is known as an inhibitor of CDPK activities, considerably reduced accumulation of resveratrol and expression of STS genes in grapevine cell cultures with the salicylic acid (SA)-and precursor-induced stilbene accumulation (Kiselev et al 2013a). In our recent investigations, we found that overexpression of CPK20 and CPK29 genes in grapevine cell cultures considerably increased tresveratrol production, while overexpression of CPK3a, CPK9, CPK13, and CPK21 genes did not have a consistent positive effect on stilbene production (Kiselev et al 2013b;Aleynova-Shumakova et al 2014;Aleynova et al 2015;Dubrovina et al 2016). These results indicate that some CDPKs are implicated in the regulation of stilbene biosynthesis as positive regulators.…”