Survivin gene expression in early‐stage non‐small cell lung cancer

Abstract

Survivin is an inhibitor of apoptosis protein, overexpressed in most human malignancies and implicated in mitosis regulation and preservation of cell viability. In order to investigate the prevalence and clinical significance of survivin in early-stage non-small cell lung carcinoma (NSCLC), survivin mRNA levels and protein expression were evaluated, using quantitative real-time RT-PCR and immunohistochemistry, respectively, in a series of 83 patients with stage I (IA and IB) surgically resected NSCLC. Detectable survivin mRNA levels could be demonstrated in all non-neoplastic lung tissue samples and in the tumours analysed. Survivin mRNA levels were elevated in 80 carcinomas (96%) compared to normal lung (p = 0.008). Among all tumours, survivin transcripts were present at a higher level in squamous cell carcinomas (p = 0.0022). Cytoplasmic and nuclear immunoreactivity was found in 70% and 80% of tumours, respectively and both were present in 54%. Cytoplasmic immunoreactivity correlated with tumour stage (p = 0.019). Survivin expression levels did not correlate with patient survival. In one specimen, cytoplasmic and focal nuclear immunostaining was observed in dysplastic bronchial squamous metaplasia. These results document that survivin overexpression is almost always present in early-stage NSCLC, suggesting that this protein may play a role in lung tumourigenesis. This ubiquitous expression makes survivin an appealing new target for novel therapies in lung cancer. In addition, this study also documents that survivin overexpression could be exploited for diagnostic purposes and that quantitative real-time RT-PCR can be a useful tool for evaluating survivin activation in NSCLC.

Nuclear and cytoplasmic expression of survivin in 67 surgically resected pancreatic cancer patients

“…Interestingly, nuclear Survivin localisation in gastric (Okada et al, 2001) and transitional cell carcinoma (Lehner et al, 2002) is considered predictive of a favourable prognosis. Recently, Survivin has been detected in the nucleus of non-smallcell lung cancer cells from clinical samples, without any significant relation with clinical outcome (Falleni et al, 2003).…”

Modulation of pro- and anti-apoptotic factors in human melanoma cells exposed to histone deacetylase inhibitors

“…Nucleotide sequences of PCR primers were: TRAIL-R1-sense-5 CGATGTGGTCAGAGCTGGTACAGC-3 and antinsense-5 -GGACACGGCAGAGCCTGTGCCAT C-3 , 217 bp amplified fragment; TRAIL-R2-sense-5 -GGGAGCCGCTCATGAGGAAGTTGG-3 and antisense-5 GGCAAGTCTCTCTCCCAGCGT CTC-3 , 182 bp amplified product; 19 survivin-sense 5 AAG-AACTGGCCCTTCTTGGA-3 and antisense-5 CAA-CCGGACGAATGCTTTTT-3 , 147 bp amplified fragment; 20 NOXA-sense-5 GTCCGAGGTGCTCCA-GTT-3 and antisense-5 AAACGTGCACTCCCTG-AGA-3 (external primers) and sense-5 -GGGCTCTG-TCGCTGAG-3 and antisense-5 -TCGACCTCCTGAG-AAAACT-3 (internal primers) 226 bp amplified fragment; 21 Mcl-1-sense-5 CACGAGACGGTCTTCC-AAGGCATGCT-3 and antisense-5 -CTAGGTTGC-TAGGGTGCAACTCT AGGA-3 , 496 bp amplified product. GAPDH was used as housekeeping gene to control for loading.…”

Nuclear survivin as a biomarker for non-small-cell lung cancer

“…Survivin protein level examined by immunostaining was associated with vascular invasion and poor survival (Ikehara et al, 2002). However, the predictive value of survivin mRNA examined by RT -PCR is contradictory between two independent studies (Monzo et al, 1999, Falleni et al, 2003. Survivin staining was found in both nucleus and cytoplasm of non-small-cell lung cancer (NSCLC) (Falleni et al, 2003).…”

“…However, the predictive value of survivin mRNA examined by RT -PCR is contradictory between two independent studies (Monzo et al, 1999, Falleni et al, 2003. Survivin staining was found in both nucleus and cytoplasm of non-small-cell lung cancer (NSCLC) (Falleni et al, 2003). Nuclear survivin rather than the cytoplasmic staining was shown to be predictive of poor survival in patients with oesophageal cancers (Grabowski et al, 2003).…”