Targeting multicopy prophage genes for the differential diagnosis of Lyme disease

Abstract

The successful treatment of Lyme disease (LD) requires an accurate diagnostic test; however, most tests are insensitive and unspecific. To overcome these challenges, we developed and validated an internally-controlled quantitative PCR (Ter-qPCR) that targets the multicopy terminase large subunit (terL) gene encoded by prophages that are only found in LD-causing bacteria. The terL protein helps phages pack their DNA. Strikingly, the detection limit of the Ter-qPCR was analytically estimated to be 22 copies and one bacterial cell in bacteria spiked blood. Furthermore, significant quantitative differences in terms of the amount of terL detected in healthy individuals and patients with either early or late disease. Together, the data suggests that the prophage-targeting PCR has significant power to provide a differential diagnosis for LD. Prophage encoded markers are prevalent in many other pathogenic bacteria rendering this approach highly applicable to bacterial identification in general, potentially revolutionising the detection of disease.

Combining citizen science and molecular diagnostic methods to investigate the prevalence of Borrelia burgdorferi s.l. and Borrelia miyamotoi in tick pools across Great Britain

“…P184103.EP.01/T.) ( Shan et al, 2018 ). Briefly, a pair of PCR primers and a probe (the Bmer-qPCR) were designed using the PrimerQuest® Tool to amplify a 120 bp region of the Borrelia miyamotoi FR64b terL gene (GenBank accession CP004220.1), The primers were F terBm :AGCCTACCTAGATCCTGCTTAT and R terBm :GGGTCACTTGCTGGTAGTTT.…”

Overcoming the Challenges of Lyme Disease Diagnosis: The Role of Phage-based Testing

“…The specificity of bacteriophages in targeting a single bacterial species forms the foundation for using phages as proxies for bacterial presence. A strong correlation between phages and their corresponding bacterial hosts has been well-established in scientific literature, as evidenced by numerous publications [8,9,42,65,80,81]. Progress in developing phage-based molecular markers for bacterial identification has been significantly influenced by our growing understanding of Borrelia phages, which are associated with LD.…”

“…To address this issue, it is crucial to explore novel, highly sensitive testing methods. One such promising approach currently under investigation involves the utilization of Borrelia-specific phages as a diagnostic tool, which holds the potential to improve the accuracy and efficiency of LD detection [8,9,42].…”

“…Unique phage sequences present in Borrelia species serve as effective indicators for bacterial identification, providing a valuable proxy for detecting these bacteria. With multiple phage genes present per Borrelia cell, the detectable signal is higher for phages than for bacteria [8,42]. Experimental evidence has shown that Borrelia phages can be released outside the Borrelia cells [42,[86][87][88].…”

“…This is particularly true for prophages, which reside within the bacteria themselves. The interest in phage-based diagnostic tools stems from their tight correlation with their bacterial hosts and their potential to be present in higher concentrations compared to bacterial cells [7][8][9]. As a result, researchers are focusing on developing novel phagebased diagnostic tools for various bacterial infections.…”