Telomere length as a prognostic parameter in chronic lymphocytic leukemia with special reference to VH gene mutation status

Abstract

B-cell chronic lymphocytic leukemia (CLL) consists of 2 prognostic entities where cases with mutated immunoglobulin V H genes have better outcome than unmutated cases. V H -mutated CLLs display longer telomeres compared with unmutated cases and telomere length has been indicated to predict outcome, although the prognostic value of telomere length has not been fully established in CLL. We analyzed telomere length, V H gene mutation status, and clinical parameters in a large series of CLL. Telomere length was assessed by quantitative polymerase chain reaction (PCR), giving a very good correlation to telomere length estimated by Southern blotting (P < .001). The prognostic information given by mutation status (n ‫؍‬ 282) and telomere length (n ‫؍‬ 246) was significant (P < .001, respectively). Telomere length was a prognostic factor for stage A (P ‫؍‬ .021) and stage B/C (P ‫؍‬ .018) patients, whereas mutation status predicted outcome only in stage A patients (P < .001). Furthermore, mutated CLLs were subdivided by telomere length into 2 groups with different prognoses (P ‫؍‬ .003), a subdivision not seen for unmutated cases (P ‫؍‬ .232). Interestingly, the V H -mutated group with short telomeres had an overall survival close to that of the unmutated cases. Thus, by combining V H mutation status and telomere length, an improved subclassification of CLL was achieved identifying previously unrecognized patient groups with different outcomes. IntroductionThe end structures of the chromosomes, the telomeres, are composed of a repetitive DNA sequence, (TTAGGG) n , and specific proteins bound to the DNA. 1,2 The telomeres protect the chromosomes from degradation, prevent end-to-end fusions, and are crucial for control of replicative senescence. In humans, the telomeres have an average length of 5 kilobases (kb) to 15 kb and in normal somatic cells the telomeric DNA shortens with 100 base pair (bp) to 200 bp every cell division due to the end-replication problem. [3][4][5] The erosion of the telomeres can be counteracted by telomerase, an enzyme that adds TTAGGG repeats to the chromosomal ends. 6 Telomere maintenance, usually executed by telomerase, is a prerequisite for an extended or infinite cellular lifespan, and studies of telomere dynamics have been in focus ever since it was shown that telomerase activity is present in almost 90% of all malignant tumors. [7][8][9] The nearly exclusive presence of telomerase in tumor cells has made the enzyme a theoretically attractive target for cancer therapy. In contrast, telomerase is restricted to a few normal cell types in humans, including germ cells, stem cells, activated lymphocytes, and epithelial cells with high reproductive demand. [10][11][12][13][14] Additionally, during the germinal center (GC) reaction in lymph nodes a high level of telomerase activity is expressed in the GC B cells accompanied by a unique telomere lengthening process not observed in other cells in vivo. [15][16][17] Telomere length reduction has been found with increasing age and was recently impli...

Igβ(CD79b) mRNA expression in chronic lymphocytic leukaemia cells correlates with immunoglobulin heavy chain gene mutational status but does not serve as an independent predictor of clinical severity

“…In the search for additional predictors of CLL prognosis, a number of genetic and biochemical markers have been proposed. These include determinations of CD38 surface expression [21,[44][45][46], chromosomal abnormalities [24,47,48], telomere length [49], and thymidine kinase expression [50][51][52]. The utility of certain biological markers, e.g., CD38 [23,24,44] and chromosomal abnormalities [46,48] may be unreliable and/or compromised by instability during the course of the disease.…”

Telomere length is an independent predictor of survival, treatment requirement and Richter's syndrome transformation in chronic lymphocytic leukemia

“…22 On the basis of these premises, it is not surprising that TL bears independent prognostic value in CLL. 28,29 Previous studies have shown that TL associates with IGHV homology, high-risk cytogenetics and poor TFS. 25,26 Subsequent reports outlined the existence of patients in which discordance exists between TL and IGHV-MS and suggested a superior predictive value of TL.…”

“…[24][25][26][27] Although early studies postulated that telomere length (TL) was mostly acting as a surrogate marker for IGHV-MS, a number of subsequent reports indicated that in discordant cases TL performed better than IGHV-MS, suggesting that TL deserved further consideration as a prognostic biomarker in CLL. 28,29 Despite these encouraging results, additional experience needs to be accumulated on TL as a prognostic marker in CLL. First, a larger patient sample is required to establish the prognostic role of TL fully, define the optimal cutoff value and confirm results in a blinded validation series.…”

The PTEN regulator DJ‐1 is associated with hTERT expression in clear cell renal cell carcinoma

“…The technique was evaluated in an earlier study from our laboratory 33 showing a significant correlation with Southern blot results. Several modifications to the original protocol were included in the present study and the following primers were used: tel 1b CGGTTTGTTTGGGTTTGGGTTTGG GTTTGGG TTTGGGTT; tel 2b GGCTTGCCTTA-CCCTTAC CCTTACCCTTACCCTTACCCT;HBG3:TGTGCTGGCCCAT CACTTTG; HBG4: ACCAGCCACCACTTTCTGATAGG.…”