Testing of rye-specific markers located on 1RS chromosome and distribution of 1AL.RS and 1BL.RS translocations in Turkish wheat (Triticum aestivum L., T. durum Desf.) varieties and landraces

Abstract

Rye (Secale cereale L.) is a valuable source for alien chromosome translocations in wheat breeding, due to its capability to grow and sustain under harsh environmental conditions. Wheat germplasm with 1AL.1RS and 1BL.1RS wheat-rye chromosome translocations have been used worldwide by breeders. Determining 1AL.1RS and 1BL.1RS translocations in wheat is therefore of important practical value for wheat improvement. In this study, nine rye-specific markers detecting the rye chromosome 1RS in wheat background were evaluated. The markers PAWS5/S6, SCM9 and O-SEC5 0 -A/O-SEC3 0 -R amplified specific bands associated with 1AL.1RS and 1BL.1RS translocations. These three markers therefore provide a quick and reliable tool to identify and to discriminate these two wheat-rye translocations in wheat background. Six out of nine rye specific markers were subsequently used to determine the frequency of these translocations in commonly grown bread and durum wheat cultivars from Turkey. One hundred seven wheat cultivars and landraces were molecularly screened. Among them, only 4% ('Seri-82', 'Yıldız-98', 'Tahirova', and 'Osmaniyem') harbor the 1BL.1RS translocation whereas the 1AL.1RS translocation was not found. The information provided here will contribute to the creation of new Turkish wheat populations with a larger genetic diversity necessary for future requirements.

Identification of Pm8 Suppressor at the Pm3 Locus in Soft Red Winter Wheat

“…The forward primer sequence is 5′TGACAACCCCCTTTCCCTCGT3′ and the reverse primer sequence is 5′TCATCGACGCTAAGGAGGACCC3′. SCM9 amplifies three alleles: a 208‐bp band associated with 1BL.1RS (containing Pm8 ), a 224‐bp band associated with 1AL.1RS (containing Pm17 ), and no band in non‐1RS lines (Heun et al, 1990; Weng et al, 2007; Yediay et al, 2010). Polymerase chain reaction was performed using a touchdown program described by Hao et al (2008).…”

Introgression of Novel Traits from a Wild Wheat Relative Improves Drought Adaptation in Wheat

“…Genes providing resistance to biotic stresses such as stem rust (Puccinia graminis), powdery mildew (Blumeria graminis f. sp. tritici), and greenbug have been successfully introgressed from rye (Secale cereale) into modern wheat germplasm (Friebe et al, 1996;Graybosch, 2001;Waines and Ehdaie, 2007;Yediay et al, 2010). In addition to pathogen resistance, the rye-wheat translocation (1RS) has been reported to have significant effects on yield, root morphology, and water and nitrogen use efficiency (Rabinovich, 1998;Ehdaie et al, 2003Ehdaie et al, , 2012Sharma et al, 2010).…”

Molecular cytogenetic identification of a novel 1AL.1RS translocation line with powdery mildew resistance

“…Rye is a valuable source for alien chromosome translocations in wheat breeding, particularly the rye 1RS chromosome, which is one of the most widely used resources for wheat improvement (Weng et al, 2007;Yediay et al, 2010). The 1RS chromosome carries numerous excellent genes; hence, many wheat-rye 1RS translocation lines have been developed by breeders.…”

“…Rye (Secale cereale L.) has a reservoir of genes that resist biotic and abiotic stresses that have been utilized widely as a valuable source of alien chromosome translocations during wheat breeding (Yediay et al, 2010). Greenbug resistance genes Gb2 and Gb6 (Porter et al, 1991) and powdery mildew resistance gene (Pm8) (Zeller and Fuchs, 1983) have been introduced into wheat via hybridization.…”