The Arabidopsis Mediator Complex Subunit16 Is a Key Component of Basal Resistance against the Necrotrophic Fungal Pathogen Sclerotinia sclerotiorum

Abstract

Although Sclerotinia sclerotiorum is a devastating necrotrophic fungal plant pathogen in agriculture, the virulence mechanisms utilized by S. sclerotiorum and the host defense mechanisms against this pathogen have not been fully understood. Here, we report that the Arabidopsis (Arabidopsis thaliana) Mediator complex subunit MED16 is a key component of basal resistance against S. sclerotiorum. Mutants of MED16 are markedly more susceptible to S. sclerotiorum than mutants of 13 other Mediator subunits, and med16 has a much stronger effect on S. sclerotiorum-induced transcriptome changes compared with med8, a mutation not altering susceptibility to S. sclerotiorum. Interestingly, med16 is also more susceptible to S. sclerotiorum than coronatine-insensitive1-1 (coi1-1), which is the most susceptible mutant reported so far. Although the jasmonic acid (JA)/ethylene (ET) defense pathway marker gene PLANT DEFENSIN1.2 (PDF1.2) cannot be induced in either med16 or coi1-1, basal transcript levels of PDF1.2 in med16 are significantly lower than in coi1-1. Furthermore, ET-induced suppression of JA-activated wound responses is compromised in med16, suggesting a role for MED16 in JA-ET cross talk. Additionally, MED16 is required for the recruitment of RNA polymerase II to PDF1.2 and OCTADECANOID-RESPONSIVE ARABIDOPSIS ETHYLENE/ETHYLENE-RESPONSIVE FACTOR59 (ORA59), two target genes of both JA/ETmediated and the transcription factor WRKY33-activated defense pathways. Finally, MED16 is physically associated with WRKY33 in yeast and in planta, and WRKY33-activated transcription of PDF1.2 and ORA59 as well as resistance to S. sclerotiorum depends on MED16. Taken together, these results indicate that MED16 regulates resistance to S. sclerotiorum by governing both JA/ET-mediated and WRKY33-activated defense signaling in Arabidopsis.

Transcriptional Regulation of Pattern-Triggered Immunity in Plants

“…In addition, MED25 as well as its interacting subunit CDK8 also regulate the expression of ERF1 and ORA59 by binding to their promoters (Cevik et al, 2012; Zhu et al, 2014). Moreover, MED16 directly interacts with WRKY33, a member of the WRKY family of plant-specific transcription factors (discussed below in detail) and is essential for the recruitment of RNAPII to the WRKY33 target genes PDF1.2 and ORA59, suggesting a specific role of MED16 in mediating the transcriptional regulation of WRKY33 target genes (Wang et al, 2015). MED18 also interacts with multiple transcription factors involved in defense responses, flowering time control and ABA signaling.…”

The Mediator Complex Subunits MED14, MED15, and MED16 Are Involved in Defense Signaling Crosstalk in Arabidopsis

“…To compare the function of different Arabidopsis Mediator subunits in the SA, JA, and ET signaling pathways, we tested SA-induced expression of the SA pathway marker gene PATHOEGNESIS-RELATED GENE1 ( PR1 ), MeJA-induced expression of the wound-responsive marker gene VEGATATIVE STORAGE PROTEIN1 ( VSP1 ) and the defense marker gene PLANT DEFENSIN1.2 ( PDF1.2 ), and ACC-induced expression of PDF1.2 in the previously described 13 Mediator subunit mutants except that a med33a/b double mutant was used to replace the med33b single mutant (Wang et al, 2015b). Ten-day-old seedlings of the wild-type Col-0 and the 13 Mediator mutants grown on ½12 × MS medium were treated with SA, MeJA, or ACC.…”

“…ecotype Columbia (Col-0). All Mediator mutants except med33b were previously described (Wang et al, 2015b). The med33b mutant (SALK_037472) and med15 / nbr4-4 (SAIL_792_F02) were obtained from the Arabidopsis Biological Resource Center at The Ohio State University (Columbus, OH, USA).…”

“…Primers used for PR1, VSP1 , and PDF1.2 were described previously (Defraia et al, 2010; Wang et al, 2015b). Primers used for HEL are forward: 5′GTGAGTGCTTATTGCTCCAC3′ and reverse: 5′ACATCCAAATCCAAGCCTCC3′, and for CHIB are forward: 5′GGTTCTGGATGACTGCTCAG3′ and reverse: 5′CTATACGATCGGCGACTCTC3′.…”

“…We have previously shown that the Arabidopsis Mediator complex subunit MED16 is required for ET-promoted inhibition of JA-mediated wound signaling (Wang et al, 2015b), indicating that some of the Mediator subunits may be involved in defense signaling crosstalk. Here, we compared SA-, methyl jasmonate (MeJA)-, and the ET precursor 1-aminocyclopropane-1-carboxylic acid (ACC)-induced defense and/or wound-responsive marker gene expression in 14 Arabidopsis Mediator subunit mutants and identified MED14, MED15, and MED16 as key players in plant defense signaling crosstalk.…”