The Cannabinoid Receptor Interacting Proteins 1 of zebrafish are not required for morphological development, viability or fertility

Fin, Laura; Bergamin, Giorgia; Steiner, Roberto A.; Hughes, Simon M.

doi:10.1038/s41598-017-05017-5

Cited by 12 publications

(16 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Myogenin mutants were generated targeting the sequence 5′-GGAGCTCCTGTCCTGATATC-3′ on the reverse strand using CRISPR/Cas9 method as previously described 79 . Mutant lines, myog kg125 and myog kg128 , were bred onto Tg(Ola.Actb:Hsa.HRAS-EGFP) vu119 .…”

Section: Methodsmentioning

confidence: 99%

Myogenin promotes myocyte fusion to balance fibre number and size

et al. 2018

Self Cite

View full text Add to dashboard Cite

Each skeletal muscle acquires its unique size before birth, when terminally differentiating myocytes fuse to form a defined number of multinucleated myofibres. Although mice in which the transcription factor Myogenin is mutated lack most myogenesis and die perinatally, a specific cell biological role for Myogenin has remained elusive. Here we report that loss of function of zebrafish myog prevents formation of almost all multinucleated muscle fibres. A second, Myogenin-independent, fusion pathway in the deep myotome requires Hedgehog signalling. Lack of Myogenin does not prevent terminal differentiation; the smaller myotome has a normal number of myocytes forming more mononuclear, thin, albeit functional, fast muscle fibres. Mechanistically, Myogenin binds to the myomaker promoter and is required for expression of myomaker and other genes essential for myocyte fusion. Adult myog mutants display reduced muscle mass, decreased fibre size and nucleation. Adult-derived myog mutant myocytes show persistent defective fusion ex vivo. Myogenin is therefore essential for muscle homeostasis, regulating myocyte fusion to determine both muscle fibre number and size.

show abstract

Section: Methodsmentioning

confidence: 99%

Myogenin promotes myocyte fusion to balance fibre number and size

et al. 2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) genome editing (28) was used to target scxa (zv11, Chr19: 3001919-3001938, GGGGGTGGCGGACGGCTGAT) and scxb ( zv11, Chr16: 31,396,781-31,396,801, GGCTATGGTTCCTTTAAGCT) and yielded 2 nonsense alleles for scxa ( scxa kg141 , scxa kg170 ) and 1 for scxb (scxb kg107 ), all of which led to premature stop codons upstream of the bHLH domain (Supplemental Fig. S1).…”

Section: Methodsmentioning

confidence: 99%

Scleraxis genes are required for normal musculoskeletal development and for rib growth and mineralization in zebrafish

et al. 2019

Self Cite

View full text Add to dashboard Cite

Tendons are an essential part of the musculoskeletal system, connecting muscle and skeletal elements to enable force generation. The transcription factor scleraxis marks vertebrate tendons from early specification. Scleraxis‐null mice are viable and have a range of tendon and bone defects in the trunk and limbs but no described cranial phenotype. We report the expression of zebrafish scleraxis orthologs: scleraxis homolog (scx)‐a and scxb in cranial and intramuscular tendons and in other skeletal elements. Single mutants for either scxa or scxb, generated by clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR‐associated protein 9 (Cas9), are viable and fertile as adult fish. Although scxb mutants show no obvious phenotype, scxa mutant embryos have defects in cranial tendon maturation and muscle misalignment. Mutation of both scleraxis genes results in more severe defects in cranial tendon differentiation, muscle and cartilage dysmorphogenesis and paralysis, and lethality by 2–5 wk, which indicates an essential function of scleraxis for craniofacial development. At juvenile and adult stages, ribs in scxa mutants fail to mineralize and/or are small and heavily fractured. Scxa mutants also have smaller muscle volume, abnormal swim movement, and defects in bone growth and composition. Scleraxis function is therefore essential for normal craniofacial form and function and vital for fish development.—Kague, E., Hughes, S. M., Lawrence, E. A., Cross, S., Martin‐Silverstone, E., Hammond, C. L., Hinits, Y. Scleraxis genes are required for normal musculoskeletal development and for rib growth and mineralization in zebrafish. FASEB J. 33, 9116–9130 (2019). http://www.fasebj.org

show abstract

“…The CB1 cannabinoid receptor-interacting protein 1 (CNRIP1), for example, is a protein involved in synaptic plasticity and modulates neurotransmission (Howlett et al, 2010) and was differentially expressed in the offspring of parents that were behaviourally sensitive to elevated CO2. Previous studies on zebrafish revealed that CNRIP1 is highly expressed in the nervous system, particularly in developing fish, and CNRIP1 interacts with the cannabinoid receptor 1, a receptor critical for the functional development of vision and locomotion (Fin et al, 2017;Oltrabella et al, 2017). In the offspring of tolerant parents, we further found differentially expressed proteins, such as the vascular cell adhesion protein (VCAM-1), to be involved in cellular process and organ development (Kong et al, 2018).…”

Section: Discussionmentioning

confidence: 70%

Proteomic responses to ocean acidification in the brain of juvenile coral reef fish

Tsang

Welch

Munday

et al. 2020

Preprint

View full text Add to dashboard Cite

Elevated CO2 levels predicted to occur by the end of the century can affect the physiology and behaviour of marine fishes. For one important survival mechanism, the response to chemical alarm cues from conspecifics, substantial among-individual variation in the extent of behavioural impairment when exposed to elevated CO2 has been observed in previous studies. Whole brain transcriptomic data has further emphasized the importance of parental phenotypic variation in the response of juvenile fish to elevated CO2. In this study, we investigate the genome-wide proteomic responses of this variation in the brain of 5-week old spiny damselfish, Acanthochromis polyacanthus. We compared the expression of proteins in the brains of juvenile A. polyacanthus from two different parental behavioural phenotypes (sensitive and tolerant) that had been experimentally exposed to short-term, long-term and inter-generational elevated CO2. Our results show differential expression of key proteins related to stress response and epigenetic markers with elevated CO2 exposure. Proteins related to neurological development were also differentially expressed particularly in the long-term developmental treatment, which might be critical for juvenile development. By contrast, exposure to elevated CO2 in the parental generation resulted in only three differentially expressed proteins in the offspring, revealing potential for inter-generational acclimation. Lastly, we found a distinct proteomic pattern in juveniles due to the behavioural sensitivity of parents to elevated CO2, even though the behaviour of the juvenile fish was impaired regardless of parental phenotype. Our data shows that developing juveniles are affected in their brain protein expression by elevated CO2, but the effect varies with the length of exposure as well as due to variation of parental phenotypes in the population.

show abstract

The Cannabinoid Receptor Interacting Proteins 1 of zebrafish are not required for morphological development, viability or fertility

Cited by 12 publications

References 46 publications

Myogenin promotes myocyte fusion to balance fibre number and size

Myogenin promotes myocyte fusion to balance fibre number and size

Scleraxis genes are required for normal musculoskeletal development and for rib growth and mineralization in zebrafish

Proteomic responses to ocean acidification in the brain of juvenile coral reef fish

Contact Info

Product

Resources

About