The expression of substance P and its neurokinin-1 receptor mRNA in the bovine corpus luteum of early developmental stage

Reibiger, Ina; Aust, Gabriela; Tscheudschilsuren, Gerelsul; Beyer, Robert E.; Gebhardt, Claudia; Spanel‐Borowski, Katharina

doi:10.1016/s0304-3940(00)01763-8

Cited by 18 publications

(3 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…After the first-strand cDNA synthesis, samples were amplified for preprotachykinin A. Since the ovine preprotachykinin A mRNA sequence was not available from data bases, primers were identical to those previously described by others [33] for the bovine sequence (P01289). The sense primer, spanning exon 1 and exon 2, started at position 123 of the published nucleotide sequence, and the antisense primer, in exon 3, ends at position 323 (sense, GGGTCAGCTGCGAAATCC; antisense, CTTGGGTCTCCGAGCGATTACT).…”

Section: Methodsmentioning

confidence: 99%

Substance P-Immunoreactive Cells in the Ovine Pars Tuberalis

et al. 2008

View full text Add to dashboard Cite

The pars tuberalis (PT) is a distinct subdivision of the anterior pituitary gland that plays a central role in regulating seasonal prolactin release. In sheep, there is compelling evidence that seasonal changes in light, transformed into a melatonin signal, are interpreted by the PT to modulate the release of a factor which affects prolactin release. The identity of this factor(s) is unknown but has been preemptively called ‘tuberalin’. In the present study, we report on an initial immunocytochemical investigation where we have identified that many ovine PT cells are immunoreactive for the tachykinin substance P (SP). Few cells in the pars distalis immunoreact for SP. The SP-immunoreactive cells did not colocalize with β-luteinizing hormone. RT-PCR confirmed the presence of preprotachykinin A mRNA in the PT. We hypothesize that SP, and possibly other preprotachykinin A-derived tachykinins, may play a role in the seasonal regulation of prolactin secretion in sheep.

show abstract

Section: Methodsmentioning

confidence: 99%

Substance P-Immunoreactive Cells in the Ovine Pars Tuberalis

et al. 2008

View full text Add to dashboard Cite

show abstract

“…It has also been suggested that eosinophils influence the process of angiogenesis during luteal development 26,27 . The chemokine responsible for the selective migration of eosinophils may be Substance P, because it is produced in the developing CL, along with its receptor, neurokinin‐1 receptor 28 . Although eotaxin was proposed to play this role, Vogel et al.…”

Section: Leukocytes In Follicular Development Ovulation and Luteinizmentioning

confidence: 99%

The Interface of the Immune and Reproductive Systems in the Ovary: Lessons Learned from the Corpus Luteum of Domestic Animal Models

Pate

Toyokawa

Walusimbi

et al. 2010

American J Rep Immunol

View full text Add to dashboard Cite

Citation Pate JL, Toyokawa K, Walusimbi S, Brzezicka E. The interface of the immune and reproductive systems in the ovary: lessons learned from the corpus luteum of domestic animal models. Am J Reprod Immunol 2010 The dynamic changes that characterize the female reproductive system are regulated by hormones. However, local cell‐to‐cell interactions may mediate responsiveness of tissues to hormonal signals. The corpus luteum (CL) is an excellent model for understanding how immune cells are recruited into tissues and the role played by those cells in regulating tissue homeostasis or demise. Leukocytes are recruited into the CL throughout its lifespan, and leukocyte‐derived cytokines have been found in corpora lutea of all species examined. The proinflammatory cytokines inhibit gonadotropin‐stimulated steroidogenesis, profoundly stimulate prostaglandin synthesis by luteal cells, and promote apoptosis. However, there is mounting evidence that leukocytes and luteal cells communicate in different ways to maintain homeostasis within the functional CL. Domestic animals have provided important information regarding the presence and role of immune cells in the CL.

show abstract

“…To determine the sequence of the equine NK1R gene, primers based on the bovine NK1R sequence (Reibiger et al 2001), were used with an equine intestinal cDNA sample. After optimisation of the reaction, a single PCR product of approximately 375 bp was obtained and submitted to the University of Guelph's Laboratory Services for automated sequencing.…”

Section: Sequencing the Equine Neurokinin-1 Receptor Mrnamentioning

confidence: 99%