The genomic organization and expression of the WT1 gene

Gessler, Manfred; König, A.; Bruns, G. A. P.

doi:10.1016/0888-7543(92)90313-h

Cited by 122 publications

(65 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Allele-specific transcription of WT1 was studied on PCR products that were amplified using two sets of primers (Jinno et al, 1994), i.e., one set (WTCA3 and WTCB3) flanking the polymorphic CA repeat sequences (Gessler et al, 1992) and the other set (WTHfa and WYHfb) for a HinfI restriction fragment length polymorphism (RFLP) (Hoban and Kesley, 1990), both located in the 3"-untranslated region (UTR) of WT1. The sequences of the two primer sets (5" to 3') are as follows: WTCA3, ATCCATTGTTTAAAGATGGTCG; WTCB3, GTAAATAATAAATTCCCTCCCTT; WTHfa, AATCAGAGAGCAAGGCA-TCG; WTHfb, GTGCAAGGAGGTATGTACATC.…”

Section: Methodsmentioning

confidence: 99%

Polymorphic and tissue-specific imprinting of the human wilms tumor gene,WT1

1997

View full text Add to dashboard Cite

SummaryWe previously demonstrated maternal monoaltelic expression of the Wilms tumor suppressor gene, WT1, in about half of pre-term placental villus and fetal brain tissues examined. There were two alternative explanations for this pattern of the WT1 expression, i.e., an imprinting polymorphism vs. a developmental stage-dependent switching from monoatlelic to biallelic expression of the gene. To investigate these possibilities, we examined WT1 expression in a larger number of villus samples (46 samples) with gestational ages ranging from 4 to 21 weeks, using reverse transcriptase-based polymerase chain reaction (RT-PCR) to amplify the sequences for polymorphic sites in the 3'-untranslated region (UTR) of WT1. Maternal monoallelic expression was observed in 7 (39%) of 18 samples informative for the polymorphism, while the expression of the remaining 11 samples was biallelic. In addition, there was no correlation between expression patterns and gestational ages of the samples. The results indicate that the pattern of expression (monoallelic vs. biallelic) is polymorphic. The expression patterns were also studied in five different organs from a 21-week-old fetus, showing monoallelic expression only in the placenta and biallelic expression in other organs (heart, lung, liver and intestine). The finding supports the tissue specificity of the WT1 monoallelic expression°

show abstract

Section: Methodsmentioning

confidence: 99%

Polymorphic and tissue-specific imprinting of the human wilms tumor gene,WT1

1997

View full text Add to dashboard Cite

show abstract

“…Although several chromosomal regions may be involved in the development of Wilms' tumor (Bonetta et al, 1990;Gessler et al, 1992;Slater and Mannens, 1992), only one gene has been cloned: the WT1 gene (Call et al, 1990). About 10% of all Wilms' tumors have homozygous mutations in the WT1 gene and, consequently, WT1 was classi®ed as a tumor suppressor gene.…”

Section: Introductionmentioning

confidence: 99%

EGR-1 enhances tumor growth and modulates the effect of the Wilms' tumor 1 gene products on tumorigenicity

et al. 2000

View full text Add to dashboard Cite

The Wilms' tumor 1 gene (WT1) encodes a transcription factor of the zinc-®nger family and is homozygously mutated or deleted in a subset of Wilms' tumors. Through alternative mRNA splicing, the gene is expressed as four main polypeptides that dier by a stretch of 17 amino acids just N-terminal of the four zinc-®ngers and three amino acids between zinc ®ngers 3 and 4. We have previously shown that expression of the WT1(7/7) isoform, lacking both inserts, increases the tumor growth rate of the adenovirus-transformed baby rat kidney (AdBRK) cell line 7C3H2, whereas expression of the WT1(7/+) isoform, lacking the 17aa insert, strongly suppresses the tumorigenic phenotype. In the present study we show that expression of these splice variants does not aect the tumorigenic potential of the similar AdBRK cell line, 7C1T1. In contrast to the 7C3H2 cell line, this AdBRK cell line expresses high endogenous levels of EGR-1 (early growth response-1) protein, a transcription factor structurally related to WT1. Ectopic expression of EGR-1 in the 7C3H2 AdBRK cells signi®cantly increases their in vivo growth rate and nulli®es the tumor suppressor activity of the WT1(7/+) protein. Furthermore, we ®nd that EGR-1 levels are elevated in some Wilms' tumors. These data are the ®rst to show that EGR-1 overexpression causes enhanced tumor growth and that WT1 and EGR-1 exert antagonizing eects on growth regulation in baby rat kidney cells, which might re¯ect the situation in some Wilms' tumors. Oncogene (2000) 19, 791 ± 800.

show abstract

“…[1][2][3][4] The function of WT1 is complicated and unclear; it regulates a variety of proteins as a transcription factor, some as an activator and some as a repressor. 5 Multiple cancers demonstrate significantly increased expression of WT1, including myelodysplastic syndromes, acute myeloblastic leukemias, acute lymphoblastic leukemias (ALL), chronic myelogenous leukemia (CML), [6][7][8][9][10] and many solid tumors 11 including mesotheliomas, 12 ovarian cancer, 13 and various gastrointestinal 14,15 and central nervous system (CNS) tumors.…”

Section: Introductionmentioning

confidence: 99%