The Microcosm Mediates the Persistence of Shiga Toxin-Producing Escherichia coli in Freshwater Ecosystems

Abstract

bWater is a major route for infection of humans by exotoxin-producing bacteria, including Shiga toxin-producing Escherichia coli (STEC). While STEC has the potential to be present in nearly every type of water source, its distribution is sporadic, and an understanding of factors that govern its emergence and persistence within water is lacking. In this study, we examined the influence of microbe content on STEC persistence in freshwater. We found that depletion of microbes in the water leads to a considerable increase in the persistence of STEC, an effect that can be mitigated by adding grazing protists to the water. STEC strains appear to be more resistant to the impact of grazing protists than E. coli strains that lack the Shiga toxin (stx) gene. Our results demonstrate that the microcosm can dramatically influence the persistence of STEC in aquatic ecosystems and that the overall impact by microbes on STEC strains is fundamentally different from that of non-STEC strains of bacteria. Overall, these results provide insight into why STEC and possibly other exotoxin-producing bacterial pathogens display such variability in abundance, distribution, and persistence in aquatic ecosystems.

The different ecological niches of enterotoxigenic Escherichia coli

“…Enterotoxigenic E. coli apparently persist in sterile filtered lake water without forming biofilms (Lothigius et al ., ). The number of bacteria detected by polymerase chain reaction methods remains stable for prolonged periods in sterile microcosms although culturable bacteria decline at a faster pace (Lothigius et al ., ; Mauro et al ., ). A small fraction of the remaining bacteria may enter a persister state of resting cells (Lewis, ).…”

Cheating, facilitation and cooperation regulate the effectiveness of phage‐encoded exotoxins as antipredator molecules

“…Taq Man probe 5′‐CAGTTATTTTGCTGTGGATATACGA‐3′ labeled with fluorescent reporter dye HEX at the 5′ end and with the Black Hole Quencher (BHQ_1) at the 3′ end (Mauro et al., ).The primers and probes targeting the uidA ( E. coli ) gene were,…”

“…Forward primer 5′-ATTAACCACACCCCACCG-3′, Reverse primer 5′-GTCATGGAAACCGTTGTCAC-3′, TaqMan probe 5′-CAGTTATTTTGCTGTGGATATACGA-3′ labeled with fluorescent reporter dye HEX at the 5′ end and with the Black Hole Quencher (BHQ_1) at the 3′ end (Mauro et al, 2013).The primers and probes targeting the uidA (E. coli) gene were, Forward primer 5′-GTGTGATATCTACCCGCTTCGC-3′, Reverse primer 5′-AGAACGGTTTGTGGTTAATCAGGA-3′, and…”

“…As such, bacteria in all phyla have developed an array of antipredator defense strategies. Our earlier investigations demonstrate that Shiga toxin (Stx) encoding bacteriophage in E. coli can provide a bacterial population with the ability to combat predation by phagocytic predators (Arnold & Koudelka, ; Lainhart, Stolfa, & Koudelka, ; Mauro, Opalko, Lindsay, Colon, & Koudelka, ; Stolfa & Koudelka, ). We also showed previously that in the face of attack by predator, a only minor subset of bacteria lysogenized with temperate Stx‐encoding lambdoid phage produce and release sufficient exotoxin to substantially reduce of predation the balance of the (Arnold & Koudelka, ; Lainhart et al., ; Stolfa & Koudelka, ).…”

“…encoding bacteriophage in E. coli can provide a bacterial population with the ability to combat predation by phagocytic predators (Arnold & Koudelka, 2014;Lainhart, Stolfa, & Koudelka, 2009;Mauro, Opalko, Lindsay, Colon, & Koudelka, 2013;Stolfa & Koudelka, 2012).…”