The NAC-type transcription factor CaNAC46 regulates the salt and drought tolerance of transgenic Arabidopsis thaliana

Abstract

Background The NAC (NAM, ATAF1/ATAF2, and CUC2) transcription factors belong to a large family of plant-specific transcription factors in monocot and dicot species. These transcription factors regulate the expression of stress tolerance-related genes that protect plants from various abiotic stresses, including drought, salinity, and low temperatures. Results In this study, we identified the CaNAC46 transcription factor gene in Capsicum annuum. Its open reading frame was revealed to comprise 921 bp, encoding a protein consisting of 306 amino acids, with an isoelectric point of 6.96. A phylogenetic analysis indicated that CaNAC46 belongs to the ATAF subfamily. The expression of CaNAC46 was induced by heat, cold, high salt, drought, abscisic acid, salicylic acid, and methyl jasmonate treatments. Thus, CaNAC46 may be important for the resistance of dry pepper to abiotic stresses. A subcellular localization analysis confirmed that CaNAC46 is localized in the nucleus. The overexpression of CaNAC46 improved the tolerance of transgenic Arabidopsis thaliana plants to drought and salt stresses. The CaNAC46-overexpressing lines had longer roots and more lateral roots than wild-type lines under prolonged drought and high salt stress conditions. Additionally, CaNAC46 affected the accumulation of reactive oxygen species (ROS). Moreover, CaNAC46 promoted the expression of SOD, POD, RD29B, RD20, LDB18, ABI, IAA4, and P5CS. The malondialdehyde contents were higher in TRV2-CaNAC46 lines than in wild-type plants in response to drought and salt stresses. Furthermore, the expression levels of stress-responsive genes, such as ABA2, P5CS, DREB, RD22, CAT, and POD, were down-regulated in TRV2-CaNAC46 plants. Conclusions Under saline and drought conditions, CaNAC46 is a positive regulator that activates ROS-scavenging enzymes and enhances root formation. The results of our study indicate CaNAC46 is a transcriptional regulator responsible for salinity and drought tolerance and suggest the abiotic stress-related gene regulatory mechanisms controlling this NAC transcription factor are conserved between A. thaliana and pepper.

Overexpression of Cassava MeAnn2 Enhances the Salt and IAA Tolerance of Transgenic Arabidopsis

“…The AtRD29B is one of the key stress response genes always analyzed in gene function analysis. Its up-regulated expression is usually associated with the tolerance of transgenic plants to salt or other abiotic stresses [ 35 , 51 , 52 ]. In this study, we found that AtRD29B was significantly upregulated by overexpression MeAnn2 gene in Arabidopsis under salt stress.…”

“…Salt stress affects the lateral root number, root development, and root growth direction of plants by regulating the concentration gradient and redistribution of IAA [ 53 ]. The previous research indicated that the high expression of AtLBD18 and AtIAA4 was related to the salt tolerance of transgenic Arabidopsis [ 35 ]. In our analysis of transgenic Arabidopsis overexpressing MeAnn2 under salt stress, in which salt tolerance was enhanced compared to WT, it was found that the expression levels of the related genes AtIAA4 and AtLBD18 in the auxin signaling pathway were significantly increased.…”

“…Each sample of the experiment had three biological replicates, and the calculated results were plotted with Excel. The detected genes and their specific primers are as follows: AtIAA4 ( QAtIAA4 -F: GCAGAGGAGGCAATGAGTAGTG and QAtIAA4 -R: GAGCATCCAGTCACCATCTTTG), AtRD29B ( QAtRD29B -F: ATTCACCATCCAG AAGAAGAGCATC and Q AtRD29B -R: ACTTCTGGGTCTTGCTCGTCA), AtLBD18 ( QAtLBD18 -F: GTCGCTCACATCTTTGCTCTTC and QAtLBD18 -R: GTCGCTCACATC TTTGCTCTTC), AtActin ( QAtActin -F: TTCCTCATGCCATCCTCCGTCTT and Q AtActin -R: CAGCGATACCTGAGAACATAGTG) [ 35 ].…”

“…In Arabidopsis , the genes of LATERAL ORGAN BOUNDARIES DOMAIN (LBD) and INDOLE-3-ACETIC ACID (IAA) were found to contribute to the lateral root emergence [ 32 , 33 , 34 ]. Recently, it has been reported that AtLBD18 and AtIAA4 were significantly induced by salt stress in salt tolerance Capsicum annuum CaNAC4 transgenic Arabidopsis [ 35 ]. Overexpressing the CaNAC4 in Arabidopsis , the transgenic plants gain tolerance to salt stress, as their roots grew better than the control plants.…”

“…Overexpressing the CaNAC4 in Arabidopsis , the transgenic plants gain tolerance to salt stress, as their roots grew better than the control plants. Meanwhile, the root growth-related genes such as AtLBD18 and AtIAA4 were significantly up-regulated in transgenic plants [ 35 ].…”