The nuclear protein GmbZIP110 has transcription activation activity and plays important roles in the response to salinity stress in soybean

Abstract

Plant basic-leucine zipper (bZIP) transcription factors play important roles in many biological processes and are involved in the regulation of salt stress tolerance. Previously, our lab generated digital gene expression profiling (DGEP) data to identify differentially expressed genes in a salt-tolerant genotype of Glycine soja (STGoGS) and a salt-sensitive genotype of Glycine max (SSGoGM). This DGEP data revealed that the expression (log2 ratio) of GmbZIP110 was up-regulated 2.76-fold and 3.38-fold in SSGoGM and STGoGS, respectively. In the present study, the salt inducible gene GmbZIP110 was cloned and characterized through phylogenetic analysis, subcellular localization and in silico transcript abundance analysis in different tissues. The functional role of this gene in salt tolerance was studied through transactivation analysis, DNA binding ability, expression in soybean composite seedlings and transgenic Arabidopsis, and the effect of GmbZIP110 on the expression of stress-related genes in transgenic Arabidopsis was investigated. We found that GmbZIP110 could bind to the ACGT motif, impact the expression of many stress-related genes and the accumulation of proline, Na + and K + , and enhanced the salt tolerance of composite seedlings and transgenic Arabidopsis. Integrating all these results, we propose that GmbZIP110 plays a critical role in the response to salinity stress in soybean and has high potential usefulness in crop improvement.Plants encounter various biotic and abiotic stressors during their life cycle. Growth and development is delayed when plants are exposed to extreme environmental conditions, such as high salt, drought, cold, and heat. Soil salinity affects large areas of cultivated land, which are naturally present in more than 100 countries worldwide 1 . The increasing and continued salinization of cultivated land threatens global crop production, especially in irrigated systems 2 and has negative impacts on food security. The consequences are damaging in both socioeconomic and environmental terms. Increasing the salinity tolerance of crop plants may be an important contribution to the maintenance and stability of crop yields in salt-affected soils.Plants can adapt to these adverse environmental conditions by regulating the expression of a large number of genes related to abiotic stress. A number of genes, including effector and regulatory genes, are reportedly involved in the alteration of their expression in response to stressors such as salinity [3][4][5][6] . Plants may adapt to these adverse environmental conditions by regulating of the expressions of a large number of abiotic stress-related genes. Stress-related genes are categorized into the following two major groups: genes that encode structural proteins and regulatory proteins, including transcription factors (TFs), and genes encoding signal-related protein kinases 7,8 . Stress-related TFs play important roles in the regulation of stress responses, such as in salt and drought tolerance. A single TF is sufficient to control the expr...

Physiological and transcriptional responses to salt stress in salt‐tolerant and salt‐sensitive soybean (Glycine max[L.] Merr.) seedlings

“…The soybean gene GmactinII (accession number: NM_001250673, forward primer, 5′‐ATCTTGACTGAGCGTGGTTATTCC‐3′; reverse primer, 5′‐GCTGGTCCTGGCTGTCTCC‐3′) was used as an internal control for the detection of the expression of eight key genes involved in Na + homeostasis in soybean. Similar results were obtained from the relative gene expression data using the change in threshold cycle method as described by Xu et al (). The qRT‐PCR analysis was repeated in three independent experiments.…”

“…cDNA was synthesized from 3.0‐μg total RNA by PrimeScript™ RT Reagent Kit (TaKaRa) using random primers in a 20‐μl reaction system. Quantitative RT‐PCR (qRT‐PCR) was performed on a Roche Light Cycler 2.0 with Light Cycler software (build 4.1.1.21) as described previously (Xu et al, ). Briefly, 1 μl of cDNA was added to 5 μl of SYBR ® Premix Ex Taq™ (TaKaRa Bio Inc., Shiga, Japan, http://www.takara-bio.com), together with 0.8 μl of each gene‐specific primer (forward and reverse, at 10 mM), and the final volume was brought to 10 μl with DNase‐free water.…”

Overexpression of GmFDL19 enhances tolerance to drought and salt stresses in soybean

“…In soybean, the GmbZIP genes, such as GmbZIP44 , GmbZIP62 , GmbZIP78 , GmbZIP132 , GmbZIP110 and GmbZIP1 , were responsive to multiple stress treatment [15, 16, 33, 41]. In the present study, the results showed that the GmFDL19, which has a high amino acid sequence similar to the Arabidopsis ABF/AREB subfamily members, was determined to be a group A member (Fig 1A).…”

Peer Review #1 of "Transcription factors involved in abiotic stress responses in Maize (Zea mays L.) and their roles in enhanced productivity in the post genomics era (v0.1)"

“…Furthermore, the transgenic tobacco plants also showed increased seed yields compared to the control plants. Likewise, Xu et al (2016) showed that transgenic Arabidopsis and soybean seedlings overexpressing a soybean bZIP TF designated as GmbZIP110 had improved salt tolerance, suggesting that GmbZIP110 functions as a positive regulator involved in salt stress tolerance. Functional analysis of GmbZIP110 in transgenic Arabidopsis revealed that this gene could bind to the ACGT motif and regulate many downstream target genes (Cao et al, 2017).…”