The relationship between cytokines and HPV-16, HPV-16 E6, E7, and high-risk HPV viral load in the uterine cervix

Concentration levels of IL-10 and TNFαcytokines in patients with human papilloma virus (HPV) DNA+and DNA−cervical lesions

“…In contrast, Song et al (2007) reported that TNFα and IL-10 levels did not correlate with pre-cancerous lesions of the cervix after HPV infection. Still, other investigators (i.e., see Nicol et al, 2005) documented the fact that malignant transformed cervical epithelial cells had a decreased ability to express TNFα and suggested that this loss of expression by cervical cancer cells may have modulated the tumor microenvironment and thereby supported continuing tumor growth.…”

The impact of vitamin D3 intake on inflammatory markers in multiple sclerosis patients and their first-degree relatives

“…The mRNA expression levels of IL-27 and TGF-β1 genes were assessed with appropriate primers and probes and were normalized with the housekeeping gene β-actin. Suitable primers and probes sequences for IL-27p28 (Forward: GGAGCGTCTCTGCTTCATCT; Reverse: AGCTGCATCCTCTCCATGTT; Probes: FAM-CGCTTCAGCCCTTCCATGCC) [20], TGF-β1: (Forward: CAGCAACAATTCCTGGCGATA; Reverse: AAGGCGAAAGCCCTCAATTT; Probe: FAM-CTGCTGGCACCCAGCGACTCG, and β-actin (Forward: TCACCCACACTGTGCC CATCTACGA; Reverse: CAGCGGAACCGCTCATTGCCAATGG; Probe: FAM-ATGCCCTCCCC CATGCCATC) [21]-as a housekeeping control-were selected. Quantitative Real-time PCR was fulfilled for mRNA expression on a Roche Light cycler 96 (version: 1.1.0.1320, Germany) using 12.5 μl of RealQ Plus 2x Master Mix for probe (Amplicon, Denmark), 250 nM of the TaqMan probe, 500 nM of each forward and reverse primers, and 4 μl of synthesized cDNA solution in total volume of 25 μl.…”

The Indicators of Predicting Disease Outcome in HPV Carcinogenesis

“…Among HPV-infected women, IFN-gamma is significantly associated with E6, E7 HPV16 and high-risk HPV viral load in the uterine cervix. Thus, increased intralesional IFN-gamma may be considered a prognostic marker for oncogenic potential of high-risk HPV (Song et al, 2007). The multivariate logistic regression analysis showed that IFN-gamma-positive results were significantly associated with clearance of high-risk HPV after 12 months of follow-up, suggesting that intralesional IFNgamma may be a prognostic marker for clearance of high-risk HPV (Song et al, 2008).…”