The thymic cortical epithelium determines the
            <scp>TCR</scp>
            repertoire of
            <scp>IL</scp>
            ‐17‐producing γδT cells

Nitta, Takeshi; Muro, Ryunosuke; Shimizu, Yukiko; Nitta, Sachiko; Oda, Hiroyo; Ohte, Yuki; Goto, Motohito; Yanobu–Takanashi, Rieko; Narita, Tadashi; Takayanagi, Hiroshi; Yasuda, Hisataka; Okamura, Tadashi; Murata, Shigeo; Suzuki, Harumi

doi:10.15252/embr.201540096

Cited by 47 publications

(48 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…IL-17-producing γδT (γδT17) cells are predominantly generated in fetal and newborn thymus (33, 34). Two recent studies have revealed that thymic epithelial cells may foster a thymic environment for temporal control of γδT17 differentiation (22, 35) and that such temporal control of γδT17 differentiation requires mTORC1 in TECs (22). γδT17 cells mainly reside in the CD44 + CD27 − population, while IFNγ-producing γδT (γδT1) cells are enriched in the CD27 + population (34).…”

Section: Resultsmentioning

confidence: 99%

mTORC2 in Thymic Epithelial Cells Controls Thymopoiesis and T Cell Development

Wang

Cheng

Chu

et al. 2016

The Journal of Immunology

View full text Add to dashboard Cite

Thymic epithelial cells (TECs) play important roles in T cell generation. Mechanisms that control TEC development and function are still not well defined. The mammalian or mechanistic target of rapamycin complex (mTORC)2 signals to regulate cell survival, nutrient uptake, and metabolism. We report in the present study that mice with TEC-specific ablation of Rictor, a critical and unique adaptor molecule in mTORC2, display thymic atrophy, which accompanies decreased TEC numbers in the medulla. Moreover, generation of multiple T cell lineages, including conventional TCRαβ T cells, regulatory T cells, invariant NKT cells, and TCRγδ T cells, was reduced in TEC-specific Rictor-deficient mice. Our data demonstrate that mTORC2 in TECs is important for normal thymopoiesis and efficient T cell generation.

show abstract

Section: Resultsmentioning

confidence: 99%

mTORC2 in Thymic Epithelial Cells Controls Thymopoiesis and T Cell Development

Wang

Cheng

Chu

et al. 2016

The Journal of Immunology

View full text Add to dashboard Cite

show abstract

“…Somewhat paradoxically, cortical thymic epithelial cells (cTECs) are the major IL-7-producing thymic stromal cells, and they do not increase production in the absence of Aire [(Ribeiro et al, 2013) and data not shown]. But mice lacking cTECs due to a spontaneous mutation of β5t have a robust IL-17A-expressing Vγ6 + thymocyte compartment (Nitta et al, 2015). Thus, we infer that mTEC-produced IL-7 is acting locally.…”

Section: Discussionmentioning

confidence: 99%

Aire Inhibits the Generation of a Perinatal Population of Interleukin-17A-Producing γδ T Cells to Promote Immunologic Tolerance

et al. 2016

View full text Add to dashboard Cite

SUMMARY Aire's primary mechanism of action is to regulate transcription of a battery of genes in medullary thymic epithelial cells (mTECs) and, consequently, negative selection of effector T cells and positive selection of regulatory T cells. We found that Aire-deficient mice had expanded thymic and peripheral populations of perinatally generated interleukin(IL)-17A+ Vγ6+Vδ1+ T cells, considered to be “early responders” to tissue stress and to drive inflammatory reactions. Aire-dependent control of Il7 expression in mTECs regulated the size of thymic IL-17A+Vγ6+Vδ1+ compartments. In mice lacking Aire and γδ T cells, certain tissues typically targeted in the “Aire-less” disease, notably the retina, were only minimally infiltrated. IL-17A+Vγ6+Vδ1+ cells were present in the retina of wild-type mice and expanded very early in Aire-deficient mice. A putatively parallel population of IL-17A+Vγ9+Vδ2+ T cells was increased in humans lacking Aire. Thus, Aire exerts multi-faceted control of autoimmunity that extends to a population of innate-like T cells.

show abstract

“…TAGAP −/− mice were generated using the CRISPR/Cas9 genome editing system. Single‐guide (sg) RNA‐targeting TAGAP (5′‐gacccagagaagtcggatgaagg‐3′) was synthesized and cloned into the sgRNA expression vector (Operon Biotechnologies, Tokyo, Japan) as previously described 30 . The sgRNA (50 ng μl −1 ) and hCas9 mRNA (100 ng μl −1 ) were co‐injected into the cytoplasm of pronuclear fertilized eggs, and the eggs were subsequently transferred into the oviducts of pseudopregnant female ICR mice.…”

Section: Methodsmentioning

confidence: 99%

T‐cell activation RhoGTPase‐activating protein plays an important role in T_H17‐cell differentiation

et al. 2017

Self Cite

View full text Add to dashboard Cite

T-cell activation RhoGTPase-activating protein (TAGAP) is a GTPase-activating protein specific for RhoA that is exclusively expressed in activated T cells. Genome-wide association studies and metagenome SNPs analyses have indicated that TAGAP is associated with the pathogenesis of multiple autoimmune diseases, including psoriasis, rheumatoid arthritis, Crohn's disease, celiac disease and multiple sclerosis. However, the precise function of TAGAP remains unclear. Because T17 cells contribute to TAGAP-associated autoimmune diseases, we hypothesized that TAGAP plays key roles in the differentiation and/or function of T17 cells. To evaluate this hypothesis, we analyzed the effect of TAGAP on T17 differentiation in vitro and established a line of TAGAP-deficient mice. We found that TAGAP was required for T17 differentiation in vitro and that the loss of TAGAP in mice ameliorated the clinical features of experimental autoimmune encephalomyelitis, indicating that TAGAP is critical for disease progression. We also demonstrated that TAGAP interacts with RhoH, an adapter protein that interacts with lck and ZAP70 in proximal TCR signaling. TAGAP competes with ZAP70 for RhoH binding, thereby inhibiting TCR-associated signal transduction. Consistent with these findings, TCR-induced ERK activation was increased in TAGAP-deficient T cells. Because the upregulation of TCR signaling inhibits Th17 differentiation, TAGAP may prevent TCR signaling activity from reaching the limit of the induction of T17 cells. Collectively, our findings indicate that TAGAP is a novel factor required for T17-cell differentiation and that TAGAP potentially represents a novel target of autoimmune disease therapies.

show abstract

The thymic cortical epithelium determines the TCR repertoire of IL ‐17‐producing γδT cells

Cited by 47 publications

References 70 publications

mTORC2 in Thymic Epithelial Cells Controls Thymopoiesis and T Cell Development

mTORC2 in Thymic Epithelial Cells Controls Thymopoiesis and T Cell Development

Aire Inhibits the Generation of a Perinatal Population of Interleukin-17A-Producing γδ T Cells to Promote Immunologic Tolerance

T‐cell activation RhoGTPase‐activating protein plays an important role in T_H17‐cell differentiation

Contact Info

Product

Resources

About

The thymic cortical epithelium determines the TCR repertoire of IL ‐17‐producing γδT cells

Cited by 47 publications

References 70 publications

mTORC2 in Thymic Epithelial Cells Controls Thymopoiesis and T Cell Development

mTORC2 in Thymic Epithelial Cells Controls Thymopoiesis and T Cell Development

Aire Inhibits the Generation of a Perinatal Population of Interleukin-17A-Producing γδ T Cells to Promote Immunologic Tolerance

T‐cell activation RhoGTPase‐activating protein plays an important role in TH17‐cell differentiation

Contact Info

Product

Resources

About

T‐cell activation RhoGTPase‐activating protein plays an important role in T_H17‐cell differentiation