Thrips Microbiome Study in Commercial Avocado (Persea americana Mill.) from Northwest Colombian Andes (Antioquia, Colombia) Shows the Presence of Wolbachia, Ehrlichia, Enterobacter

Abstract

Microbiota associated with insects play several important roles in their host, including protection against pathogens, provision of nutrition, and survival in hostile environments. The aim of this work was to identify the bacterial community found in avocado thrips from Northwestern Colombia (Antioquia department) in order to find isolates for potential biocontrol purposes. Culture-dependent methods based on 16S rRNA and gyrase B gene sequencing in 42 bacterial isolates allowed the identification of the genera Bacillus, Serratia, Moraxella, Pantoea, and Sphingomonas. Microbial diversity detected with the temperature gradient gel electrophoresis (TGGE) technique on three morphotypes of thrips, named brown (Scirtothrips hansoni), black (Frankliniella panamensis), and pale (Frankliniella sp.), showed a low bacterial community density (Shannon–Wiener index = 1480, p > 0.05) with significant differences among morphotypes (R = 0.7877, p = 0.0004). Results obtained with Illumina sequencing on the V1–V2 hypervariable region of the subunit 16S rRNA showed a predominant sequence in the brown morphotype (Scirtothrips hansoni) that belongs to the genus Wolbachia. The 16S amplicon analyses were extended to more samples and higher resolution using the V4–V5 hypervariable region. The results showed six additional bacteria phyla, confirming the previous observation for the dominant bacterial groups made in S. hansoni and the detection of the alternation of highly predominant genera among these thrips. Our results demonstrate that endosymbiont such as Wolbachia sp. are part of the microbiota of these pests, thereby indicating the possibility of employing this type of bacterium to improve the management of avocado thrips globally.

Comparative analysis of Spodoptera frugiperda (J. E. Smith) (Lepidoptera, Noctuidae) corn and rice strains microbiota revealed minor changes across life cycle and strain endosymbiont association

“…The identification of the selected bacteria was carried out through PCR of the 16S rRNA gene, using the Eubac 27F (5′AGAGTTTGATCCTGGCTCAG3′) and 1492R (5′GGT TACCTT GTT ACG ACT T3′) primers ( Espejo et al, 1998 ). To confirm the species of some of the isolates, a region of approximately 1,260 bp of the gyr B gene was amplified using the UP1 primers (5′–AGC AGG GTA CGG ATG TGC GAG CCR TCN ACR TCN GCR TCN GTC AT–3′) and UP2R (5′–GAA GTC ATC ATG ACC GTT CTG CAY GCN GGN GGN AAR TTY GA–3′) ( Yamamoto & Harayama, 1995 ) according to the protocol described by Cano-Calle et al (2022) . The PCR products of 16S rDNA and the gyr B gene were analyzed by electrophoresis in 1.2% agarose gel stained with the fluorescent marker EZ.VisionTM (Amresco, U.S.A).…”