Tumor necrosis factor alpha (TNF-?) gene polymorphism in alopecia areata

Abstract

Tumor necrosis factor alpha (TNF-alpha) phenotypes of two polymorphic systems were determined in 50 patients with alopecia areata, a common inflammatory disease of the skin. The distribution of TNF-alpha T1, T2 phenotypes differed between patients with the patchy form of disease and patients with totalis/universalis disease. There was no significant difference in the distribution of TNF-alpha G,A phenotypes between patient groups. The results of this study provide evidence of genetic heterogeneity between the two forms of alopecia areata, and suggest that the TNF-alpha gene or a closely linked locus within the major histocompatibility complex may play a role in the pathogenesis of the patchy form of disease.

Evaluation of TNF-α and IL-1β polymorphisms in Taiwan Chinese patients with pterygium

“…10,11 The A 308 allele of the TNF-a promoter affects the binding of transcription factors and increases transcription promoter activity, which may further alter TNF-a production, immune response, and susceptibility to certain autoimmune, infectious, and malignant diseases. 23 Besides, the A 308 allele may inhibit repressors of transcription.…”

“…11 The sequences of the primers were as follows: 5 0 -AGGCAATAGGTTTTGAGGGCCAT-3 0 and 5 0 -ACACTCCCCATCCTCCCGGCT-3 0 . The polymorphism was analysed by PCR amplification followed by NcoI restriction analysis.…”

“…The polymorphism was analysed by PCR amplification followed by NcoI restriction analysis. 11 For IL-1b-511 promoter, IL-1b exon 5, and IL-1 Ra, six PCR primers were used to amplify the correlated gene. The sequences of the six primers were as follows (from 5 0 to 3 0 end): IL-1b promoter: upstream, TGGCATTGATCTGGTTCATC; downstream, GTTTAGGAATTCTCCCACTT; IL-1b exon 5: upstream, GTTGTCATCAGACTTTGACC; downstream, TTCAGTTCATATGGACCAGA; and IL-1Ra: upstream, CTCAGCAACACTCCTAT; downstream, TCCTGGTCTGCAGGTAA.…”

“…As TNF-a and IL-1b are so important for pterygium formation, the TNF-a and IL-1b polymorphisms have been reported to be correlated with TNF-a and IL-1b expression, [9][10][11] and there is evidence that genetic factors may play a role in the development of pterygium, [12][13][14][15][16][17][18] it is logical to suspect a correlation between pterygium formation and TNF-a and IL-1b polymorphisms.…”

“…In this study, TNF-a-308 promoter, IL-1b-511 promoter, IL-1b exon 5, and IL-1 receptor antagonist (IL-1 Ra), which had been reported to be associated with elevated TNF and IL-1b levels, [9][10][11]19,20 were evaluated in order to understand whether these polymorphisms are associated with increased susceptibility for pterygium.…”