Two Mechanosensitive Channel Homologs Influence Division Ring Placement in Arabidopsis Chloroplasts

Abstract

Chloroplasts must divide repeatedly to maintain their population during plant growth and development. A number of proteins required for chloroplast division have been identified, and the functional relationships between them are beginning to be elucidated. In both chloroplasts and bacteria, the future site of division is specified by placement of the Filamentous temperature sensitive Z (FtsZ) ring, and the Min system serves to restrict FtsZ ring formation to mid-chloroplast or mid-cell. How the Min system is regulated in response to environmental and developmental factors is largely unstudied. Here, we investigated the role in chloroplast division played by two Arabidopsis thaliana homologs of the bacterial mechanosensitive (MS) channel MscS: MscS-Like 2 (MSL2) and MSL3. Immunofluorescence microscopy and live imaging approaches demonstrated that msl2 msl3 double mutants have enlarged chloroplasts containing multiple FtsZ rings. Genetic analyses indicate that MSL2, MSL3, and components of the Min system function in the same pathway to regulate chloroplast size and FtsZ ring formation. In addition, an Escherichia coli strain lacking MS channels also showed aberrant FtsZ ring assembly. These results establish MS channels as components of the chloroplast division machinery and suggest that their role is evolutionarily conserved.

MscS-Like10 is a stretch-activated ion channel from Arabidopsis thaliana with a preference for anions

“…Reverse genetic analyses have demonstrated that two plastid-localized homologs, MSL2 and MSL3, are required for the proper size, shape, division, and hypoosmotic volume control of plastids (14)(15)(16). In addition, two plasma membranelocalized homologs, MSL9 and MSL10, are genetically required for the predominant MS channel activity in the plasma membrane of Arabidopsis root cell protoplasts, providing support for the hypothesis that MSL proteins form MS channels (5).…”

Molecular force transduction by ion channels – diversity and unifying principles

“…MscS-like channels regulate volume and division of plastids in algae (Nakayama et al, 2007) and higher plants, including Arabidopsis (Haswell and Meyerowitz, 2006;Peyronnet et al, 2008;Wilson et al, 2011). Both MscL and MscS are found in the same bacterial cell and show functional redundancy, but in contrast with MscL, MscS is a heptamer with three TM domains (Bass et al, 2002).…”

Plastid osmotic stress influences cell differentiation at the plant shoot apex

“…The abi4-1 allele was genotyped with oligos TCAAT-CCGATTCCACCACCGAC and CCACTTCCTCCTTGTTCCTGC, and digesting with NlaI. PCR genotyping of msl, p5cs1 and aba2-1 alleles was performed as previously described Szekely et al, 2008;Wilson et al, 2011).…”

“…Quantitative reverse transcription-PCR was performed as previously described (Wilson et al, 2011). Primers used for gene expression analysis of ACTIN and ARR genes were previously described (Wilson et al, 2014;Zhao et al, 2010).…”

“…MSL2 and MSL3 are two members of the MscS-Like (MSL) family of mechanosensitive ion channels that localize to the plastid envelope and are required for normal plastid size, shape and division site selection (Haswell and Meyerowitz, 2006;Wilson et al, 2011). By analogy to family members in bacteria (Levina et al, 1999) and plants (Hamilton et al, 2015) and based on in vivo experiments (Veley et al, 2012), MSL2 and MSL3 are likely to serve as osmotic 'safety valves', allowing plastids to continuously maintain osmotic homeostasis during normal growth and development.…”