Use of next generation sequence to investigate potential novel macrolide resistance mechanisms in a population of Moraxella catarrhalis isolates

Liu, Yali; Li, Dongfang; Xu, Huanji; Xiao, Meng; Cheng, Jingwei; Zhang, Li; Xu, Zhaochun; Chen, Xinxin; Zhang, Ge; Kudinha, Timothy; Kong, Fanrong; Gong, Yanping; Wang, Xinying; Zhang, Yinxin; Wu, Honglong; Xu, Yingchun

doi:10.1038/srep35711

Cited by 5 publications

(3 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The genes mboIA and mboIB are always simultaneously present or completely absent. Previously, we had reported that mboIA and mboIB were associated with macrolide resistance [ 42 ], which was further confirmed in this study. However, the functions of mboIA and mboIB in M. catarrhalis are unknown.…”

Section: Discussionsupporting

confidence: 89%

Correlation of Moraxella catarrhalis macrolide susceptibility with the ability to adhere and invade human respiratory epithelial cells

Liu

Ding

Jia

et al. 2022

Emerging Microbes & Infections

Self Cite

View full text Add to dashboard Cite

Recently, the prevalence of macrolide-resistant Moraxella catarrhalis has been reported, especially among Chinese children. The fitness cost of resistance is reported to render the resistant bacteria less virulent. To investigate the correlation between macrolide susceptibility of M. catarrhalis and pathogenicity, the whole genome of 70 M. catarrhalis isolates belonging to four clonal complexes with different macrolide susceptibilities was sequenced. The gene products were annotated with the Gene Ontology terms. Based on 46 extracted essential virulence genes, 19 representative isolates were selected to infect type II alveolar cells (A549 cells). The ability of these isolates to adhere and invade human epithelial cells and to produce cytokines was comparatively analysed. Furthermore, mice were infected with a pair of M. catarrhalis isolates with different pathogenic behaviours and macrolide susceptibilities to examine pulmonary clearance, histological findings, and the production of cytokines. The percentages of annotations for binding, metabolic process, cellular process, and cell were non-significantly different between the macrolide-resistant and macrolide-susceptible groups. The presence of uspA2 , uspA2H , pilO , lbpB , lex1 , modM , mboIA , and mboIB significantly differed among the four clonal complexes and macrolide susceptibility groups. Furthermore, compared with those in macrolide-susceptible isolates, the adhesion ability was stronger ( P = 0.0019) and the invasion ability was weaker ( P < 0.0001) in the macrolide-resistant isolates. Mouse experiments revealed that pulmonary macrophages elicit immune responses against M. catarrhalis infection by significantly upregulating the Csf2, Il4, Il13, Il1b, Il6, Tnf, and Il18. Therefore, M. catarrhalis populations exhibited diverse pathogenicity in vitro and in vivo .

show abstract

Section: Discussionsupporting

confidence: 89%

Correlation of Moraxella catarrhalis macrolide susceptibility with the ability to adhere and invade human respiratory epithelial cells

Liu

Ding

Jia

et al. 2022

Emerging Microbes & Infections

Self Cite

View full text Add to dashboard Cite

show abstract

“…The 23S rRNA gene was amplified and sequenced using primer pairs described before (MUT-F, 5′- 2685 CAGGCTGCTGCAACTGTTTA 2704 -3′, and MUT-R, 5′- 3618 CAACCGAAACA CCAGAGGTT 3599 -3′, from M. catarrhalis KCCM: 40056; positions determined according to the bases on GenBank submission of FJ410380) ( Liu et al, 2012 , 2016 ).…”

Section: Methodsmentioning

confidence: 99%

Moraxella catarrhalis Macrolide-Resistant Isolates Are Highly Concentrated in Two MLST Clonal Complexes -CCN10 and CC363

Liu¹,

Xiao²,

Cheng³

et al. 2017

Front. Microbiol.

Self Cite

View full text Add to dashboard Cite

To gain some insights into the molecular evolution of Moraxella catarrhalis macrolide resistance, PCR and sequencing analysis of the 23S rRNA gene, copB typing and multilocus sequence typing (MLST) were performed on 181 M. catarrhalis isolates. The isolates were obtained from children (n = 47) and adults (n = 134) presenting with respiratory disease in the years 2010–2014. Macrolide resistance was highly age-related, and nucleotide position alterations at A2330T could be detected in all macrolide-resistant isolates. copB 0 and copB NT (non-typable) were only found in macrolide-susceptible isolates from adults. Furthermore, copB I/III was the main type in adult or macrolide-susceptible isolates, while copB II was the most common type in children or macrolide-resistant isolates. Twenty-two different MLST clusters (sharing 7 of the 8 identical loci) were detected and only four likely primary founders (ST224, ST363, STN08, and STN10) which belong to clonal complex (CC) 224, CC363, CCN08, and CCN10, were detected, respectively. Macrolide-resistant M. catarrhalis isolates were highly concentrated in two CCs (CCN10 and CC363), which indicates some potential evolutionary advantage or co-evolution to some extent. However, further studies are needed to fully elucidate the evolution of CCN10 and CC363 in macrolide resistance.

show abstract

“… 4 , 5 Liu et al also demonstrated that high-level macrolide-resistant strains possessed a number of mutations in the 23S rRNA gene 6 and that several genes, excluding the 23S rRNA gene and the L4 and L22 ribosomal protein-encoding genes, may be related to macrolide resistance in M. catarrhalis . 8 However, their role in macrolide resistance remains unclear because molecular functional analysis has not been performed for several of the genes identified in those studies.…”

Section: Introductionmentioning

confidence: 99%

Novel mechanism responsible for high-level macrolide resistance in <em>Moraxella catarrhalis</em>

Kasai¹,

Ohta²,

Maeda³

et al. 2018

IDR

View full text Add to dashboard Cite

BackgroundHigh-level macrolide-resistant Moraxella catarrhalis strains have been isolated; however, the underlying mechanism has not been well elucidated. We investigated the role of mutations in the 23S rRNA gene and the L4 and L22 ribosomal proteins using spontaneous erythromycin-resistant mutants and transformants.Materials and methodsThe erythromycin-susceptible M. catarrhalis ATCC25238 and clinical isolate Mc19 were used as parental strains. To obtain spontaneous erythromycin-resistant mutants, in vitro stepwise selection was performed using brain–heart infusion agar plates containing various concentrations of erythromycin. The role of the mutations identified in the spontaneous mutants was validated using transformation experiments.ResultsWe obtained two spontaneous mutants with high-level resistance to erythromycin, S25-32-af10 and S19-256-af10, from ATCC25238 and Mc19, respectively. S25-32-af10 exhibited mutations of Q61R in L4 and Insertion98SRADRIS in L22. S19-256-af10 exhibited three C2611T-mutated alleles in the 23S rRNA gene and G65A in L4. Transformants with single mutations identified in S25-32-af10 or S19-256-af10 showed higher erythromycin and azithromycin minimum inhibitory concentrations (MICs) than those of each parental strain. However, transformants with multiple mutations identified in S25-32-af10 or S19-256-af10 showed macrolide MICs similar to those of each parental strain.ConclusionOur results provide the first evidence suggesting that Q61R in L4 and Insertion98SRADRIS in L22 are involved in the synergistic acquisition of high-level resistance to both 14- and 15-member macrolides, and that C2611T in the 23S rRNA gene and G65A in L4 also synergistically contribute toward conferring high-level 14-member macrolide resistance to M. catarrhalis.

show abstract

Use of next generation sequence to investigate potential novel macrolide resistance mechanisms in a population of Moraxella catarrhalis isolates

Cited by 5 publications

References 44 publications

Correlation of Moraxella catarrhalis macrolide susceptibility with the ability to adhere and invade human respiratory epithelial cells

Correlation of Moraxella catarrhalis macrolide susceptibility with the ability to adhere and invade human respiratory epithelial cells

Moraxella catarrhalis Macrolide-Resistant Isolates Are Highly Concentrated in Two MLST Clonal Complexes -CCN10 and CC363

Novel mechanism responsible for high-level macrolide resistance in <em>Moraxella catarrhalis</em>

Contact Info

Product

Resources

About