Withanolide Derivative 2,3-Dihydro-3β-methoxy Withaferin-A Modulates the Circadian Clock via Interaction with RAR-Related Orphan Receptor α (RORa)

Abstract

Withanolide derivatives have anticancer, anti-inflammatory, and other functions and are components of Indian traditional Ayurvedic medicine. Here, we found that 2,3-dihydro-3β-methoxy withaferin-A (3βmWi-A), a derivative of withaferin-A (Wi-A) belonging to a class of withanolides that are abundant in Ashwagandha (Withania somnifera), lengthened the period of the circadian clock. This compound dose-dependently elongated circadian rhythms in Sarcoma 180 cancer cells and in normal fibroblasts including NIH3T3 and spontaneously immortalized mouse embryonic fibroblasts (MEF). Furthermore, 3βmWi-A dose-dependently upregulated the mRNA expression and promoter activities of Bmal1 after dexamethasone stimulation and of the nuclear orphan receptors, Rora and Nr1d1, that comprise the stabilization loop for Bmal1 oscillatory expression. We showed that 3βmWi-A functions as an inverse agonist for RORa with an IC50 of 11.3 μM and that 3βmWi-A directly, but weakly, interacts with RORa (estimated dissociation constant [K d], 5.9 μM). We propose that 3βmWi-A is a novel modulator of circadian rhythms.

Hydroxy-β-sanshool isolated from Zanthoxylum piperitum (Japanese pepper) shortens the period of the circadian clock

“…Mouse embryonic fibroblasts containing PER2::LUC were immortalised as described. 11 Mouse fibroblast A9 cells harbouring the multi-integrase mouse artificial chromosome (MI-MAC) vector 21 (a gift from Dr M. Oshimura, Tottori University) were cultured in high-glucose Dulbecco's modified Eagle's medium (D-MEM; FUJIFILM Wako Pure Chemical Corp.) containing 10% foetal bovine serum (FBS; Capricorn Scientific GmbH., Ebsdorfergrund, Germany) and 1% Penicillin–Streptomycin Solution X100 (Wako), under 100% humidity and a 5% CO 2 atmosphere.…”

“…Parameters for period lengths are expressed as period (h) ± asymptotic standard error. 11 For phase shift assay of Per2, A9 stable cell line (described above) was used. Four representative time points (two MESORs, peak and trough) were selected for 2 h pulse.…”

“…Real-time quantitative PCR was performed as described. 11 Total RNA was extracted using RNA iso plus (Takara Bio Inc., Kusatsu, Japan). First strand cDNA was synthesized from total RNA (1 mg) using PrimeScript RT-PCR kits (Takara Bio Inc. Gpx1, TTCGGACACCAGGAGAATGG and TAAAGAGCG-GGTGAGCCTTC (NM_008160.6; product size, 139 bp).…”

“…We investigated the early effects of hydroxy-β-sanshool on the expression of clock and clock-related genes, because it shortens the period lengths of Bmal1 and Per2, and compounds that can alter the circadian period can also change the expression profiles of clock genes. [9][10][11] We explored the effects of hydroxy-β-sanshool on Per2 on promoter activity. We transiently co-transfected NIH3T3 cells with the Per2-Luc reporter and the pRL-CMV control plasmid, and reset the endogenous clock by incubating the cells with dexamethasone for 2 h. Thereafter, the cells were incubated without (control) or with 1, 3 and 9 μg mL −1 of hydroxy-β-sanshool for 24 h, then luciferase activities were evaluated.…”

“…We previously showed that harmine, 9 lycorine 10 and 2,3-dihydro-3β-methoxy withaferin-A 11 isolated from plants can alter circadian rhythms. Therefore, other natural products might have similar or more potential to manipulate the period length of circadian clock.…”